Incidental Mutation 'R2899:1110002E22Rik'
ID261404
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission 040487-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R2899 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138065682 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 211 (K211E)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163080]
Predicted Effect probably benign
Transcript: ENSMUST00000163080
AA Change: K211E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: K211E

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik C A 2: 111,220,670 unknown Het
Amigo3 T C 9: 108,054,154 S259P probably benign Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cd200r4 T C 16: 44,833,365 I175T probably damaging Het
Cep131 T C 11: 120,072,028 D425G probably benign Het
Clmp T C 9: 40,782,392 S302P probably damaging Het
Dusp6 T C 10: 99,263,845 S52P probably damaging Het
Epha5 T A 5: 84,233,808 I395F probably damaging Het
F5 A G 1: 164,186,900 E580G possibly damaging Het
Fbxo3 T A 2: 104,051,135 Y271N probably damaging Het
Fuca1 G A 4: 135,923,012 W131* probably null Het
Gdf7 C T 12: 8,298,470 A284T unknown Het
Limk1 A T 5: 134,688,300 probably null Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Neb A G 2: 52,185,323 I210T probably benign Het
Nf1 T G 11: 79,412,758 N420K possibly damaging Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Pask G T 1: 93,334,547 T197K probably damaging Het
Pou4f3 T C 18: 42,395,523 L177P probably benign Het
Rassf1 G A 9: 107,554,194 G107R probably null Het
Rdx T C 9: 52,068,911 probably benign Het
Saraf T C 8: 34,161,231 L77P probably damaging Het
Syngap1 A G 17: 26,959,985 E656G probably damaging Het
Tsku T C 7: 98,352,917 N69S probably damaging Het
Usp36 G A 11: 118,276,756 probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zc3h6 T C 2: 129,002,232 V232A probably benign Het
Zfp143 T A 7: 110,072,129 S99R probably damaging Het
Zkscan3 A T 13: 21,393,973 L248Q probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense not run
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGAATGGAAGGCGGTAC -3'
(R):5'- GGCCATTGTCTTCTGCACTG -3'

Sequencing Primer
(F):5'- GGTACGTCTGACATGAACTCACAG -3'
(R):5'- TCTGCACTGTCCACCAGG -3'
Posted OnJan 23, 2015