Incidental Mutation 'R0334:Wnt3a'
ID26142
Institutional Source Beutler Lab
Gene Symbol Wnt3a
Ensembl Gene ENSMUSG00000009900
Gene Namewingless-type MMTV integration site family, member 3A
SynonymsWnt-3a
MMRRC Submission 038543-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0334 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location59248033-59290752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59256318 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 181 (S181P)
Ref Sequence ENSEMBL: ENSMUSP00000010044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010044]
Predicted Effect probably damaging
Transcript: ENSMUST00000010044
AA Change: S181P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000010044
Gene: ENSMUSG00000009900
AA Change: S181P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
WNT1 44 352 9.57e-218 SMART
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 96% amino acid identity to mouse Wnt3A protein, and 84% to human WNT3 protein, another WNT gene product. This gene is clustered with WNT14 gene, another family member, in chromosome 1q42 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die at embryonic day 10.5-12.5 with failed development of caudal somites, notochord and structures rostral to hindlimbs. Homozygotes for a hypomorphic allele have vertebral defects and a short tail due to loss of caudal vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,617,129 probably benign Het
Aggf1 T C 13: 95,371,597 N87S probably benign Het
Ap2b1 T C 11: 83,367,874 probably benign Het
Arfgef3 A G 10: 18,592,281 Y1724H probably damaging Het
Arhgef10l G A 4: 140,583,926 Q243* probably null Het
Atp8a2 A T 14: 59,691,512 F1031Y probably damaging Het
Bmp8b A G 4: 123,114,760 probably null Het
Brinp2 G T 1: 158,295,585 T37K probably benign Het
Bsph1 T A 7: 13,450,939 L9* probably null Het
C6 T G 15: 4,755,367 N238K probably benign Het
Cbs T C 17: 31,619,156 D373G probably damaging Het
Clec4a3 T C 6: 122,969,370 F191S possibly damaging Het
Cpz A G 5: 35,503,681 V530A probably damaging Het
Ctsc G T 7: 88,278,342 S47I possibly damaging Het
Cyp7b1 T G 3: 18,103,796 Y53S probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Defb4 T C 8: 19,201,204 I29T probably benign Het
Disc1 A T 8: 125,261,097 probably null Het
Dnah2 A G 11: 69,436,836 M3429T probably damaging Het
Dnah7a A T 1: 53,433,054 I3518N possibly damaging Het
Dnah8 A T 17: 30,871,351 H4609L probably damaging Het
Evi5 C A 5: 107,820,535 C182F probably damaging Het
Fam149b G A 14: 20,363,424 R237H probably damaging Het
Fut8 T A 12: 77,393,762 D174E possibly damaging Het
Ghr T C 15: 3,341,098 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm12794 T C 4: 101,941,584 F251L probably benign Het
Gm8882 T A 6: 132,364,058 Q17L unknown Het
Gm9573 A G 17: 35,622,722 probably benign Het
Gpr176 T C 2: 118,279,708 S357G probably benign Het
Grwd1 A T 7: 45,827,177 probably null Het
H2-T24 A G 17: 36,014,880 V273A possibly damaging Het
Hdac4 A C 1: 91,956,038 probably benign Het
Herc3 A G 6: 58,918,817 T1017A probably damaging Het
Hsd11b1 T C 1: 193,242,168 probably benign Het
Igsf23 T C 7: 19,941,753 S143G probably benign Het
Kbtbd12 T A 6: 88,617,906 Y314F probably damaging Het
Kcnmb2 A G 3: 32,198,359 probably null Het
Kdm5b A G 1: 134,604,522 I479M probably damaging Het
Kidins220 A G 12: 25,008,069 T600A probably damaging Het
Mrgprb2 A C 7: 48,552,329 I216S probably damaging Het
Myo1g A G 11: 6,511,084 probably benign Het
Nrxn3 T C 12: 89,813,642 probably null Het
Olfr706 A G 7: 106,886,415 V134A probably benign Het
Olfr921 A T 9: 38,775,239 probably null Het
Olfr943 A G 9: 39,184,684 I169V probably benign Het
Pdia5 A T 16: 35,464,390 S66T possibly damaging Het
Plec T C 15: 76,178,006 E2604G probably damaging Het
Plekha6 G T 1: 133,282,180 A654S probably benign Het
Pnpla2 G A 7: 141,459,520 probably null Het
Prkdc A G 16: 15,736,799 D2128G probably benign Het
Rabggta A T 14: 55,720,811 L131Q probably damaging Het
Rbks A T 5: 31,624,519 Y312* probably null Het
Rnf139 A G 15: 58,899,473 Y449C probably damaging Het
Sbno1 A G 5: 124,386,868 V1058A possibly damaging Het
Sema3a A T 5: 13,557,301 N321I probably damaging Het
Slit3 T A 11: 35,579,101 V310E probably damaging Het
Slitrk5 T C 14: 111,680,824 S627P probably benign Het
Stat2 T A 10: 128,277,867 F172I probably damaging Het
Tchh C A 3: 93,445,616 R788S unknown Het
Tnks T A 8: 34,853,259 K753* probably null Het
Trank1 T A 9: 111,365,353 V815D probably benign Het
Trank1 T A 9: 111,392,940 I2915N probably damaging Het
Trpc6 T C 9: 8,610,343 S271P probably damaging Het
Trpm5 T C 7: 143,086,876 Q213R probably benign Het
Ulk3 C T 9: 57,594,227 probably benign Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Yipf3 T C 17: 46,248,312 F22S possibly damaging Het
Zbtb40 A T 4: 136,986,556 H1094Q probably damaging Het
Other mutations in Wnt3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Wnt3a APN 11 59256309 missense probably benign 0.03
R3912:Wnt3a UTSW 11 59250002 missense possibly damaging 0.91
R4041:Wnt3a UTSW 11 59249644 missense probably damaging 1.00
R4980:Wnt3a UTSW 11 59249800 missense probably damaging 1.00
R5413:Wnt3a UTSW 11 59275356 missense probably benign 0.04
R5528:Wnt3a UTSW 11 59275280 missense probably damaging 0.99
R5626:Wnt3a UTSW 11 59290583 missense probably benign 0.17
R6355:Wnt3a UTSW 11 59275232 missense probably damaging 1.00
R6700:Wnt3a UTSW 11 59249761 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTTCCAGGAACCCTATGTCCACAG -3'
(R):5'- TAGCTTTCGCAGTGACACGCTC -3'

Sequencing Primer
(F):5'- GAACCCTATGTCCACAGGTGAG -3'
(R):5'- AGTGACACGCTCCTGTGC -3'
Posted On2013-04-16