Incidental Mutation 'R0334:Ap2b1'
ID26146
Institutional Source Beutler Lab
Gene Symbol Ap2b1
Ensembl Gene ENSMUSG00000035152
Gene Nameadaptor-related protein complex 2, beta 1 subunit
Synonyms1300012O03Rik
MMRRC Submission 038543-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.709) question?
Stock #R0334 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83299024-83405035 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 83367874 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523]
Predicted Effect probably benign
Transcript: ENSMUST00000018875
SMART Domains Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 2.6e-173 PFAM
Pfam:HEAT_2 88 157 3.7e-8 PFAM
Pfam:Cnd1 99 268 2.1e-40 PFAM
Pfam:HEAT_2 124 219 1.4e-9 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 950 9.93e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065692
SMART Domains Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4.2e-173 PFAM
Pfam:HEAT_2 88 157 2.7e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Alpha_adaptinC2 707 817 2.94e-18 SMART
B2-adapt-app_C 826 936 9.93e-56 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104029
Predicted Effect probably benign
Transcript: ENSMUST00000176430
SMART Domains Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4e-173 PFAM
Pfam:HEAT_2 88 157 2.8e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 936 7.22e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176523
SMART Domains Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 95 1.1e-26 PFAM
Pfam:Cnd1 69 230 1.5e-26 PFAM
Pfam:HEAT_2 85 182 5.1e-9 PFAM
Pfam:Adaptin_N 90 496 4e-125 PFAM
low complexity region 587 605 N/A INTRINSIC
low complexity region 616 637 N/A INTRINSIC
Alpha_adaptinC2 683 793 2.94e-18 SMART
B2-adapt-app_C 802 912 9.93e-56 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.6%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,617,129 probably benign Het
Aggf1 T C 13: 95,371,597 N87S probably benign Het
Arfgef3 A G 10: 18,592,281 Y1724H probably damaging Het
Arhgef10l G A 4: 140,583,926 Q243* probably null Het
Atp8a2 A T 14: 59,691,512 F1031Y probably damaging Het
Bmp8b A G 4: 123,114,760 probably null Het
Brinp2 G T 1: 158,295,585 T37K probably benign Het
Bsph1 T A 7: 13,450,939 L9* probably null Het
C6 T G 15: 4,755,367 N238K probably benign Het
Cbs T C 17: 31,619,156 D373G probably damaging Het
Clec4a3 T C 6: 122,969,370 F191S possibly damaging Het
Cpz A G 5: 35,503,681 V530A probably damaging Het
Ctsc G T 7: 88,278,342 S47I possibly damaging Het
Cyp7b1 T G 3: 18,103,796 Y53S probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Defb4 T C 8: 19,201,204 I29T probably benign Het
Disc1 A T 8: 125,261,097 probably null Het
Dnah2 A G 11: 69,436,836 M3429T probably damaging Het
Dnah7a A T 1: 53,433,054 I3518N possibly damaging Het
Dnah8 A T 17: 30,871,351 H4609L probably damaging Het
Evi5 C A 5: 107,820,535 C182F probably damaging Het
Fam149b G A 14: 20,363,424 R237H probably damaging Het
Fut8 T A 12: 77,393,762 D174E possibly damaging Het
Ghr T C 15: 3,341,098 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm12794 T C 4: 101,941,584 F251L probably benign Het
Gm8882 T A 6: 132,364,058 Q17L unknown Het
Gm9573 A G 17: 35,622,722 probably benign Het
Gpr176 T C 2: 118,279,708 S357G probably benign Het
Grwd1 A T 7: 45,827,177 probably null Het
H2-T24 A G 17: 36,014,880 V273A possibly damaging Het
Hdac4 A C 1: 91,956,038 probably benign Het
Herc3 A G 6: 58,918,817 T1017A probably damaging Het
Hsd11b1 T C 1: 193,242,168 probably benign Het
Igsf23 T C 7: 19,941,753 S143G probably benign Het
Kbtbd12 T A 6: 88,617,906 Y314F probably damaging Het
Kcnmb2 A G 3: 32,198,359 probably null Het
Kdm5b A G 1: 134,604,522 I479M probably damaging Het
Kidins220 A G 12: 25,008,069 T600A probably damaging Het
Mrgprb2 A C 7: 48,552,329 I216S probably damaging Het
Myo1g A G 11: 6,511,084 probably benign Het
Nrxn3 T C 12: 89,813,642 probably null Het
Olfr706 A G 7: 106,886,415 V134A probably benign Het
Olfr921 A T 9: 38,775,239 probably null Het
Olfr943 A G 9: 39,184,684 I169V probably benign Het
Pdia5 A T 16: 35,464,390 S66T possibly damaging Het
Plec T C 15: 76,178,006 E2604G probably damaging Het
Plekha6 G T 1: 133,282,180 A654S probably benign Het
Pnpla2 G A 7: 141,459,520 probably null Het
Prkdc A G 16: 15,736,799 D2128G probably benign Het
Rabggta A T 14: 55,720,811 L131Q probably damaging Het
Rbks A T 5: 31,624,519 Y312* probably null Het
Rnf139 A G 15: 58,899,473 Y449C probably damaging Het
Sbno1 A G 5: 124,386,868 V1058A possibly damaging Het
Sema3a A T 5: 13,557,301 N321I probably damaging Het
Slit3 T A 11: 35,579,101 V310E probably damaging Het
Slitrk5 T C 14: 111,680,824 S627P probably benign Het
Stat2 T A 10: 128,277,867 F172I probably damaging Het
Tchh C A 3: 93,445,616 R788S unknown Het
Tnks T A 8: 34,853,259 K753* probably null Het
Trank1 T A 9: 111,365,353 V815D probably benign Het
Trank1 T A 9: 111,392,940 I2915N probably damaging Het
Trpc6 T C 9: 8,610,343 S271P probably damaging Het
Trpm5 T C 7: 143,086,876 Q213R probably benign Het
Ulk3 C T 9: 57,594,227 probably benign Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Wnt3a A G 11: 59,256,318 S181P probably damaging Het
Yipf3 T C 17: 46,248,312 F22S possibly damaging Het
Zbtb40 A T 4: 136,986,556 H1094Q probably damaging Het
Other mutations in Ap2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Ap2b1 APN 11 83333158 missense probably damaging 0.99
IGL01583:Ap2b1 APN 11 83324611 missense possibly damaging 0.61
IGL01753:Ap2b1 APN 11 83321973 missense probably damaging 1.00
IGL01992:Ap2b1 APN 11 83335530 missense probably damaging 1.00
IGL02192:Ap2b1 APN 11 83346766 missense possibly damaging 0.48
IGL02315:Ap2b1 APN 11 83336799 missense probably damaging 0.96
IGL03235:Ap2b1 APN 11 83341384 missense probably benign 0.41
P0045:Ap2b1 UTSW 11 83368026 missense probably damaging 1.00
R0121:Ap2b1 UTSW 11 83321967 missense possibly damaging 0.66
R1222:Ap2b1 UTSW 11 83346738 missense probably benign 0.06
R1297:Ap2b1 UTSW 11 83333109 missense probably damaging 1.00
R1653:Ap2b1 UTSW 11 83346831 missense probably damaging 1.00
R1719:Ap2b1 UTSW 11 83324604 missense probably damaging 1.00
R1885:Ap2b1 UTSW 11 83390735 missense probably damaging 0.99
R1886:Ap2b1 UTSW 11 83390735 missense probably damaging 0.99
R1965:Ap2b1 UTSW 11 83346895 missense probably benign 0.00
R1966:Ap2b1 UTSW 11 83346895 missense probably benign 0.00
R2046:Ap2b1 UTSW 11 83336386 missense probably benign 0.14
R2086:Ap2b1 UTSW 11 83351118 missense possibly damaging 0.88
R2132:Ap2b1 UTSW 11 83324761 splice site probably benign
R3615:Ap2b1 UTSW 11 83324565 missense possibly damaging 0.84
R3616:Ap2b1 UTSW 11 83324565 missense possibly damaging 0.84
R3983:Ap2b1 UTSW 11 83390716 missense probably damaging 1.00
R4124:Ap2b1 UTSW 11 83365645 critical splice acceptor site probably null
R4125:Ap2b1 UTSW 11 83365645 critical splice acceptor site probably null
R4198:Ap2b1 UTSW 11 83342603 missense probably damaging 1.00
R4202:Ap2b1 UTSW 11 83335604 critical splice donor site probably null
R4543:Ap2b1 UTSW 11 83324650 missense probably damaging 1.00
R4583:Ap2b1 UTSW 11 83397779 missense probably benign 0.00
R4589:Ap2b1 UTSW 11 83333011 nonsense probably null
R4916:Ap2b1 UTSW 11 83390706 missense probably damaging 1.00
R5005:Ap2b1 UTSW 11 83339392 missense probably damaging 1.00
R5385:Ap2b1 UTSW 11 83342601 missense probably damaging 1.00
R5510:Ap2b1 UTSW 11 83336737 intron probably null
R5738:Ap2b1 UTSW 11 83336430 unclassified probably null
R6023:Ap2b1 UTSW 11 83335398 missense probably damaging 0.99
R6269:Ap2b1 UTSW 11 83346673 missense probably damaging 1.00
R6383:Ap2b1 UTSW 11 83346825 missense probably damaging 1.00
R6416:Ap2b1 UTSW 11 83308239 start codon destroyed probably null 0.98
R6502:Ap2b1 UTSW 11 83342679 missense probably damaging 0.97
R6810:Ap2b1 UTSW 11 83335491 missense possibly damaging 0.89
R6969:Ap2b1 UTSW 11 83389726 missense probably damaging 0.99
X0064:Ap2b1 UTSW 11 83324569 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTAACAGAAACATGGTACTCATCG -3'
(R):5'- CGTCAAACCCAGGATGTTGCTTCTTAC -3'

Sequencing Primer
(F):5'- ACATGGTACTCATCGGAATGTC -3'
(R):5'- CCTATTCTTGTTAAACTGGATGGC -3'
Posted On2013-04-16