Incidental Mutation 'R2902:Prr12'
ID261501
Institutional Source Beutler Lab
Gene Symbol Prr12
Ensembl Gene ENSMUSG00000046574
Gene Nameproline rich 12
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R2902 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45027563-45052881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45047612 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 960 (G960R)
Ref Sequence ENSEMBL: ENSMUSP00000054702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057293]
Predicted Effect unknown
Transcript: ENSMUST00000057293
AA Change: G960R
SMART Domains Protein: ENSMUSP00000054702
Gene: ENSMUSG00000046574
AA Change: G960R

DomainStartEndE-ValueType
low complexity region 135 150 N/A INTRINSIC
low complexity region 208 222 N/A INTRINSIC
low complexity region 225 242 N/A INTRINSIC
low complexity region 249 261 N/A INTRINSIC
low complexity region 330 376 N/A INTRINSIC
low complexity region 388 413 N/A INTRINSIC
low complexity region 418 444 N/A INTRINSIC
low complexity region 450 464 N/A INTRINSIC
low complexity region 469 487 N/A INTRINSIC
low complexity region 535 559 N/A INTRINSIC
low complexity region 598 616 N/A INTRINSIC
low complexity region 665 682 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
low complexity region 858 871 N/A INTRINSIC
low complexity region 883 896 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 964 986 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
low complexity region 1059 1070 N/A INTRINSIC
AT_hook 1161 1173 5.74e1 SMART
AT_hook 1193 1205 8.09e0 SMART
low complexity region 1252 1264 N/A INTRINSIC
low complexity region 1308 1328 N/A INTRINSIC
low complexity region 1417 1535 N/A INTRINSIC
low complexity region 1684 1748 N/A INTRINSIC
Pfam:DUF4211 1817 1950 6.5e-21 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a proline-rich protein that contains two A-T hook DNA binding domains. A chromosomal translocation and gene fusion between this gene and zinc finger, MIZ-type containing 1 (Gene ID: 57178) may underlie intellectual disability and neuropsychiatric problems in a human patient. Enriched expression of this gene in embryonic mouse brain suggests that this gene may play a role in nervous system development. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 G A 4: 58,809,691 T1592M probably benign Het
Apobec2 T C 17: 48,423,381 T86A probably benign Het
C1qtnf1 A G 11: 118,448,104 probably null Het
Cacng3 A G 7: 122,754,527 K78R possibly damaging Het
Cep68 A G 11: 20,240,187 L275P probably damaging Het
Chrm4 A G 2: 91,927,957 K237E probably benign Het
Clvs1 A G 4: 9,281,972 K139E probably damaging Het
Col25a1 A T 3: 130,546,391 E351V probably damaging Het
Cyp4f18 A T 8: 72,002,411 I107N probably damaging Het
Dagla A G 19: 10,248,103 L899P probably damaging Het
Dnah3 T C 7: 119,951,499 K3199R possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam186a G T 15: 99,945,168 T1065K possibly damaging Het
Ferd3l T G 12: 33,928,953 M155R probably damaging Het
Fgd4 A G 16: 16,425,865 Y602H probably damaging Het
Gldn T C 9: 54,335,814 L360P possibly damaging Het
Gm9920 C A 15: 55,112,471 probably benign Het
Inhbc T C 10: 127,357,752 T132A probably benign Het
Krt23 T C 11: 99,483,971 D260G probably damaging Het
Lrch3 G A 16: 32,950,396 A123T probably damaging Het
Mark2 A T 19: 7,283,448 S408T probably benign Het
Nme8 A T 13: 19,675,664 V23E probably benign Het
Nod2 A T 8: 88,675,463 I912F probably damaging Het
Nxpe4 A G 9: 48,394,146 I279V probably benign Het
Oas3 A G 5: 120,758,917 F880L probably damaging Het
Olfr251 T A 9: 38,378,041 N53K possibly damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Olfr993 C T 2: 85,414,052 V276M possibly damaging Het
Pcnt C T 10: 76,375,230 R2371H probably damaging Het
Prex2 A T 1: 11,208,614 N1389I possibly damaging Het
Prf1 A T 10: 61,300,319 N125Y probably damaging Het
Rap1b A G 10: 117,824,602 S17P probably damaging Het
Rhot2 G T 17: 25,843,976 Q63K probably damaging Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Slco1a6 A G 6: 142,096,320 L510P probably damaging Het
Ssc4d G A 5: 135,964,663 P113L possibly damaging Het
Sv2a A T 3: 96,193,756 N690I possibly damaging Het
Tbc1d24 T C 17: 24,207,246 Y452C probably benign Het
Tmem132d G T 5: 127,783,768 H1096Q probably benign Het
Tmem82 C A 4: 141,616,464 G165V probably benign Het
Tpo T A 12: 30,119,449 T96S possibly damaging Het
Triobp A G 15: 78,973,418 E1073G possibly damaging Het
Tspoap1 C T 11: 87,777,975 P1358L probably benign Het
Usp47 A G 7: 112,093,451 Y1020C probably damaging Het
Washc4 C A 10: 83,554,763 Y153* probably null Het
Other mutations in Prr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Prr12 APN 7 45047458 missense unknown
IGL01603:Prr12 APN 7 45043485 missense probably damaging 0.96
IGL01941:Prr12 APN 7 45048659 unclassified probably benign
IGL02043:Prr12 APN 7 45050005 unclassified probably benign
IGL02170:Prr12 APN 7 45046188 missense unknown
IGL02494:Prr12 APN 7 45028846 missense unknown
IGL02947:Prr12 APN 7 45048556 missense unknown
R0128:Prr12 UTSW 7 45050039 unclassified probably benign
R0255:Prr12 UTSW 7 45049991 unclassified probably benign
R0556:Prr12 UTSW 7 45030669 missense unknown
R1168:Prr12 UTSW 7 45029047 missense unknown
R1266:Prr12 UTSW 7 45050253 unclassified probably benign
R1374:Prr12 UTSW 7 45046218 missense unknown
R1531:Prr12 UTSW 7 45028530 missense unknown
R1537:Prr12 UTSW 7 45028942 missense unknown
R1572:Prr12 UTSW 7 45028800 missense unknown
R1617:Prr12 UTSW 7 45049594 unclassified probably benign
R1647:Prr12 UTSW 7 45034192 missense probably benign 0.20
R1694:Prr12 UTSW 7 45028579 missense unknown
R1732:Prr12 UTSW 7 45048356 missense unknown
R1819:Prr12 UTSW 7 45048697 unclassified probably benign
R2114:Prr12 UTSW 7 45046082 missense unknown
R2210:Prr12 UTSW 7 45049351 unclassified probably benign
R2846:Prr12 UTSW 7 45046012 missense unknown
R2985:Prr12 UTSW 7 45046012 missense unknown
R4094:Prr12 UTSW 7 45047947 missense unknown
R4498:Prr12 UTSW 7 45045914 missense unknown
R4523:Prr12 UTSW 7 45048523 missense unknown
R4763:Prr12 UTSW 7 45047695 missense unknown
R4775:Prr12 UTSW 7 45051325 unclassified probably benign
R4995:Prr12 UTSW 7 45051229 unclassified probably benign
R5007:Prr12 UTSW 7 45049801 unclassified probably benign
R5045:Prr12 UTSW 7 45049894 unclassified probably benign
R5184:Prr12 UTSW 7 45046377 missense unknown
R5897:Prr12 UTSW 7 45043384 missense probably damaging 1.00
R6847:Prr12 UTSW 7 45045740 missense unknown
R6912:Prr12 UTSW 7 45048845 unclassified probably benign
R7147:Prr12 UTSW 7 45033850 missense unknown
X0066:Prr12 UTSW 7 45047003 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGACTGTGGAGGGAAGCTC -3'
(R):5'- TCTGGAACCATTGCCGTCAG -3'

Sequencing Primer
(F):5'- CAGGAGGTTTGTTGTGATCCAGAC -3'
(R):5'- TGTGGGACCACCTAACTCG -3'
Posted On2015-01-23