Incidental Mutation 'R2902:Pcnt'
ID261512
Institutional Source Beutler Lab
Gene Symbol Pcnt
Ensembl Gene ENSMUSG00000001151
Gene Namepericentrin (kendrin)
Synonymsm239Asp, m275Asp, Pcnt2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2902 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location76351263-76442786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76375230 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 2371 (R2371H)
Ref Sequence ENSEMBL: ENSMUSP00000001179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001179] [ENSMUST00000217838]
Predicted Effect probably damaging
Transcript: ENSMUST00000001179
AA Change: R2371H

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001179
Gene: ENSMUSG00000001151
AA Change: R2371H

DomainStartEndE-ValueType
internal_repeat_1 7 78 2.47e-5 PROSPERO
low complexity region 104 114 N/A INTRINSIC
coiled coil region 131 229 N/A INTRINSIC
internal_repeat_3 241 259 6.69e-5 PROSPERO
low complexity region 313 325 N/A INTRINSIC
internal_repeat_3 391 409 6.69e-5 PROSPERO
low complexity region 456 467 N/A INTRINSIC
coiled coil region 468 520 N/A INTRINSIC
coiled coil region 554 581 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
coiled coil region 727 787 N/A INTRINSIC
coiled coil region 871 916 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
low complexity region 969 985 N/A INTRINSIC
coiled coil region 1055 1383 N/A INTRINSIC
coiled coil region 1429 1481 N/A INTRINSIC
coiled coil region 1529 1567 N/A INTRINSIC
low complexity region 1614 1624 N/A INTRINSIC
internal_repeat_2 1916 1964 2.47e-5 PROSPERO
coiled coil region 2158 2178 N/A INTRINSIC
coiled coil region 2211 2279 N/A INTRINSIC
coiled coil region 2300 2421 N/A INTRINSIC
coiled coil region 2447 2526 N/A INTRINSIC
Pfam:PACT_coil_coil 2718 2797 5.8e-29 PFAM
internal_repeat_1 2820 2885 2.47e-5 PROSPERO
internal_repeat_2 2844 2891 2.47e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000217838
AA Change: R2353H

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220395
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display mitotic spindle misorientation, microcephaly, craniofacial developmental anomalies, such as cleft palate and eye defects, variable structural kidney and cardiovascular defects, and altered hemodynamics leading to heart failure and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 G A 4: 58,809,691 T1592M probably benign Het
Apobec2 T C 17: 48,423,381 T86A probably benign Het
C1qtnf1 A G 11: 118,448,104 probably null Het
Cacng3 A G 7: 122,754,527 K78R possibly damaging Het
Cep68 A G 11: 20,240,187 L275P probably damaging Het
Chrm4 A G 2: 91,927,957 K237E probably benign Het
Clvs1 A G 4: 9,281,972 K139E probably damaging Het
Col25a1 A T 3: 130,546,391 E351V probably damaging Het
Cyp4f18 A T 8: 72,002,411 I107N probably damaging Het
Dagla A G 19: 10,248,103 L899P probably damaging Het
Dnah3 T C 7: 119,951,499 K3199R possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam186a G T 15: 99,945,168 T1065K possibly damaging Het
Ferd3l T G 12: 33,928,953 M155R probably damaging Het
Fgd4 A G 16: 16,425,865 Y602H probably damaging Het
Gldn T C 9: 54,335,814 L360P possibly damaging Het
Gm9920 C A 15: 55,112,471 probably benign Het
Inhbc T C 10: 127,357,752 T132A probably benign Het
Krt23 T C 11: 99,483,971 D260G probably damaging Het
Lrch3 G A 16: 32,950,396 A123T probably damaging Het
Mark2 A T 19: 7,283,448 S408T probably benign Het
Nme8 A T 13: 19,675,664 V23E probably benign Het
Nod2 A T 8: 88,675,463 I912F probably damaging Het
Nxpe4 A G 9: 48,394,146 I279V probably benign Het
Oas3 A G 5: 120,758,917 F880L probably damaging Het
Olfr251 T A 9: 38,378,041 N53K possibly damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Olfr993 C T 2: 85,414,052 V276M possibly damaging Het
Prex2 A T 1: 11,208,614 N1389I possibly damaging Het
Prf1 A T 10: 61,300,319 N125Y probably damaging Het
Prr12 C T 7: 45,047,612 G960R unknown Het
Rap1b A G 10: 117,824,602 S17P probably damaging Het
Rhot2 G T 17: 25,843,976 Q63K probably damaging Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Slco1a6 A G 6: 142,096,320 L510P probably damaging Het
Ssc4d G A 5: 135,964,663 P113L possibly damaging Het
Sv2a A T 3: 96,193,756 N690I possibly damaging Het
Tbc1d24 T C 17: 24,207,246 Y452C probably benign Het
Tmem132d G T 5: 127,783,768 H1096Q probably benign Het
Tmem82 C A 4: 141,616,464 G165V probably benign Het
Tpo T A 12: 30,119,449 T96S possibly damaging Het
Triobp A G 15: 78,973,418 E1073G possibly damaging Het
Tspoap1 C T 11: 87,777,975 P1358L probably benign Het
Usp47 A G 7: 112,093,451 Y1020C probably damaging Het
Washc4 C A 10: 83,554,763 Y153* probably null Het
Other mutations in Pcnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Pcnt APN 10 76422904 nonsense probably null
IGL01307:Pcnt APN 10 76411588 missense probably damaging 1.00
IGL01549:Pcnt APN 10 76367486 splice site probably null
IGL01576:Pcnt APN 10 76368822 missense probably damaging 0.99
IGL01611:Pcnt APN 10 76436424 critical splice donor site probably null
IGL01630:Pcnt APN 10 76420246 missense probably damaging 0.99
IGL01647:Pcnt APN 10 76370001 nonsense probably null
IGL01689:Pcnt APN 10 76411653 missense probably damaging 1.00
IGL01690:Pcnt APN 10 76392775 missense probably damaging 1.00
IGL01723:Pcnt APN 10 76418499 missense possibly damaging 0.63
IGL01920:Pcnt APN 10 76404528 missense probably damaging 1.00
IGL01958:Pcnt APN 10 76433679 missense probably damaging 0.96
IGL02210:Pcnt APN 10 76389219 missense possibly damaging 0.95
IGL02225:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02228:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02237:Pcnt APN 10 76352984 missense probably damaging 1.00
IGL02279:Pcnt APN 10 76403765 missense probably damaging 1.00
IGL02303:Pcnt APN 10 76442559 splice site probably benign
IGL02355:Pcnt APN 10 76375162 nonsense probably null
IGL02362:Pcnt APN 10 76375162 nonsense probably null
IGL02428:Pcnt APN 10 76429256 missense probably damaging 0.99
IGL02536:Pcnt APN 10 76380229 missense possibly damaging 0.68
IGL02715:Pcnt APN 10 76368722 splice site probably benign
IGL02800:Pcnt APN 10 76412583 nonsense probably null
IGL03395:Pcnt APN 10 76436491 missense possibly damaging 0.95
IGL02799:Pcnt UTSW 10 76412583 nonsense probably null
PIT4520001:Pcnt UTSW 10 76420235 missense probably damaging 0.99
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0109:Pcnt UTSW 10 76389196 missense probably benign 0.00
R0117:Pcnt UTSW 10 76408727 nonsense probably null
R0254:Pcnt UTSW 10 76392580 missense probably benign 0.10
R0392:Pcnt UTSW 10 76384826 missense probably benign
R0511:Pcnt UTSW 10 76404595 missense possibly damaging 0.66
R0570:Pcnt UTSW 10 76412107 missense probably damaging 1.00
R0614:Pcnt UTSW 10 76420316 missense probably damaging 1.00
R0635:Pcnt UTSW 10 76404585 missense probably damaging 1.00
R0707:Pcnt UTSW 10 76420541 missense probably damaging 1.00
R0749:Pcnt UTSW 10 76381364 missense probably damaging 1.00
R0969:Pcnt UTSW 10 76427951 missense probably damaging 1.00
R1172:Pcnt UTSW 10 76393044 splice site probably null
R1174:Pcnt UTSW 10 76393044 splice site probably null
R1175:Pcnt UTSW 10 76393044 splice site probably null
R1512:Pcnt UTSW 10 76404662 splice site probably null
R1542:Pcnt UTSW 10 76389387 missense probably benign 0.08
R1542:Pcnt UTSW 10 76401386 missense probably benign 0.02
R1558:Pcnt UTSW 10 76422922 missense possibly damaging 0.53
R1562:Pcnt UTSW 10 76367330 missense probably benign 0.02
R1762:Pcnt UTSW 10 76355137 critical splice acceptor site probably null
R1779:Pcnt UTSW 10 76408796 missense probably damaging 0.99
R1869:Pcnt UTSW 10 76379906 missense probably null 0.94
R1911:Pcnt UTSW 10 76368816 missense possibly damaging 0.94
R1985:Pcnt UTSW 10 76380337 missense possibly damaging 0.95
R1995:Pcnt UTSW 10 76392799 nonsense probably null
R2073:Pcnt UTSW 10 76380380 missense possibly damaging 0.92
R2111:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2112:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2309:Pcnt UTSW 10 76442626 start gained probably benign
R3623:Pcnt UTSW 10 76433750 missense probably benign 0.23
R4088:Pcnt UTSW 10 76428014 missense probably damaging 1.00
R4300:Pcnt UTSW 10 76367391 missense probably benign 0.40
R4402:Pcnt UTSW 10 76392393 missense probably benign 0.00
R4407:Pcnt UTSW 10 76374870 missense possibly damaging 0.90
R4483:Pcnt UTSW 10 76401483 missense probably damaging 1.00
R4647:Pcnt UTSW 10 76354213 missense probably benign 0.01
R4734:Pcnt UTSW 10 76437206 missense probably benign 0.25
R4747:Pcnt UTSW 10 76436465 missense possibly damaging 0.91
R4782:Pcnt UTSW 10 76409577 missense possibly damaging 0.62
R4795:Pcnt UTSW 10 76370024 missense probably benign 0.21
R4831:Pcnt UTSW 10 76412501 missense probably damaging 0.96
R4873:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4875:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4946:Pcnt UTSW 10 76356185 missense probably damaging 1.00
R5032:Pcnt UTSW 10 76355077 missense probably benign 0.00
R5033:Pcnt UTSW 10 76399945 missense possibly damaging 0.95
R5106:Pcnt UTSW 10 76401444 missense probably damaging 1.00
R5118:Pcnt UTSW 10 76412168 missense probably damaging 0.98
R5167:Pcnt UTSW 10 76420424 missense probably damaging 0.97
R5199:Pcnt UTSW 10 76418544 missense probably benign 0.09
R5223:Pcnt UTSW 10 76380272 missense probably damaging 0.99
R5241:Pcnt UTSW 10 76433617 missense probably benign 0.26
R5308:Pcnt UTSW 10 76356325 nonsense probably null
R5328:Pcnt UTSW 10 76411719 missense probably damaging 1.00
R5454:Pcnt UTSW 10 76389547 splice site probably null
R5543:Pcnt UTSW 10 76412052 missense probably benign 0.01
R5588:Pcnt UTSW 10 76442611 missense possibly damaging 0.74
R5647:Pcnt UTSW 10 76385841 missense probably benign 0.17
R5668:Pcnt UTSW 10 76409500 missense probably benign 0.16
R5712:Pcnt UTSW 10 76429271 missense probably damaging 0.96
R5714:Pcnt UTSW 10 76420491 missense probably damaging 1.00
R5797:Pcnt UTSW 10 76392756 missense probably benign 0.00
R5946:Pcnt UTSW 10 76382063 missense possibly damaging 0.91
R5955:Pcnt UTSW 10 76411622 missense possibly damaging 0.45
R6024:Pcnt UTSW 10 76420037 missense possibly damaging 0.87
R6267:Pcnt UTSW 10 76385798 missense probably benign 0.02
R6485:Pcnt UTSW 10 76389330 nonsense probably null
R6605:Pcnt UTSW 10 76429198 critical splice donor site probably null
R6877:Pcnt UTSW 10 76434017 missense possibly damaging 0.94
R6882:Pcnt UTSW 10 76427828 missense probably benign 0.00
R6919:Pcnt UTSW 10 76385798 missense probably benign 0.02
R7025:Pcnt UTSW 10 76403835 missense probably damaging 1.00
R7098:Pcnt UTSW 10 76384839 missense probably benign
R7109:Pcnt UTSW 10 76369904 missense probably damaging 1.00
R7121:Pcnt UTSW 10 76427927 missense possibly damaging 0.73
R7143:Pcnt UTSW 10 76389060 missense possibly damaging 0.47
R7152:Pcnt UTSW 10 76411360 intron probably null
R7213:Pcnt UTSW 10 76408904 missense probably damaging 1.00
R7368:Pcnt UTSW 10 76400001 missense probably benign
R7453:Pcnt UTSW 10 76389450 missense probably benign
R7486:Pcnt UTSW 10 76418436 missense probably benign 0.03
R7486:Pcnt UTSW 10 76418437 missense probably benign
R7538:Pcnt UTSW 10 76399939 missense not run
Predicted Primers PCR Primer
(F):5'- TCCAACGCACGAGTCTTCTC -3'
(R):5'- TCACCCTATAGTCCTGAGTATGG -3'

Sequencing Primer
(F):5'- GCTCAGCTGCTCTGTCAG -3'
(R):5'- CTGAGTATGGTTTTAACCCAT -3'
Posted On2015-01-23