Incidental Mutation 'R0334:Nrxn3'
ID26153
Institutional Source Beutler Lab
Gene Symbol Nrxn3
Ensembl Gene ENSMUSG00000066392
Gene Nameneurexin III
Synonyms4933401A11Rik, 9330112C09Rik, D12Bwg0831e, neurexin III alpha, neurexin III beta, neurexin III alpha, neurexin III beta
MMRRC Submission 038543-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0334 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location88722876-90334935 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 89813642 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057634] [ENSMUST00000110130] [ENSMUST00000110133] [ENSMUST00000163134] [ENSMUST00000167103] [ENSMUST00000167887] [ENSMUST00000190626]
Predicted Effect probably benign
Transcript: ENSMUST00000057634
SMART Domains Protein: ENSMUSP00000050075
Gene: ENSMUSG00000066392

DomainStartEndE-ValueType
LamG 94 246 3.28e-41 SMART
EGF 273 307 4.1e-2 SMART
LamG 332 470 4.87e-26 SMART
LamG 518 654 7.08e-37 SMART
EGF 688 722 1.99e1 SMART
LamG 750 907 1.14e-17 SMART
low complexity region 948 964 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
4.1m 1046 1064 4.38e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110130
SMART Domains Protein: ENSMUSP00000105757
Gene: ENSMUSG00000066392

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamG 107 264 1.14e-17 SMART
Blast:LamG 294 410 6e-47 BLAST
low complexity region 492 507 N/A INTRINSIC
4.1m 510 528 4.38e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110133
SMART Domains Protein: ENSMUSP00000105760
Gene: ENSMUSG00000066392

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamG 107 234 1.8e-20 SMART
Blast:LamG 264 330 1e-19 BLAST
low complexity region 358 373 N/A INTRINSIC
4.1m 376 394 4.38e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163134
SMART Domains Protein: ENSMUSP00000129678
Gene: ENSMUSG00000066392

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 843 4.87e-26 SMART
LamG 891 1027 7.08e-37 SMART
EGF 1052 1086 1.99e1 SMART
LamG 1114 1271 1.14e-17 SMART
low complexity region 1312 1328 N/A INTRINSIC
low complexity region 1395 1406 N/A INTRINSIC
low complexity region 1499 1514 N/A INTRINSIC
4.1m 1517 1535 4.38e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167103
SMART Domains Protein: ENSMUSP00000127407
Gene: ENSMUSG00000066392

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 834 5.76e-28 SMART
LamG 882 1018 7.08e-37 SMART
EGF 1043 1077 1.99e1 SMART
LamG 1105 1262 1.14e-17 SMART
low complexity region 1303 1319 N/A INTRINSIC
low complexity region 1354 1382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167887
SMART Domains Protein: ENSMUSP00000127926
Gene: ENSMUSG00000066392

DomainStartEndE-ValueType
LamG 94 246 3.28e-41 SMART
EGF 273 307 4.1e-2 SMART
LamG 332 470 4.87e-26 SMART
LamG 518 654 7.08e-37 SMART
EGF 688 722 1.99e1 SMART
LamG 750 907 1.14e-17 SMART
low complexity region 948 964 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
4.1m 1046 1064 4.38e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190626
SMART Domains Protein: ENSMUSP00000139879
Gene: ENSMUSG00000066392

DomainStartEndE-ValueType
LamG 94 246 2.1e-43 SMART
EGF 273 307 2e-4 SMART
LamG 332 470 3.1e-28 SMART
LamG 518 654 4.4e-39 SMART
EGF 688 722 9.6e-2 SMART
LamG 750 877 1.1e-22 SMART
low complexity region 918 934 N/A INTRINSIC
low complexity region 972 1000 N/A INTRINSIC
Meta Mutation Damage Score 0.482 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. [provided by RefSeq, Dec 2012]
PHENOTYPE: Twenty percent of mice homozygous for a knock-out allele die postnatally prior to 20 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,617,129 probably benign Het
Aggf1 T C 13: 95,371,597 N87S probably benign Het
Ap2b1 T C 11: 83,367,874 probably benign Het
Arfgef3 A G 10: 18,592,281 Y1724H probably damaging Het
Arhgef10l G A 4: 140,583,926 Q243* probably null Het
Atp8a2 A T 14: 59,691,512 F1031Y probably damaging Het
Bmp8b A G 4: 123,114,760 probably null Het
Brinp2 G T 1: 158,295,585 T37K probably benign Het
Bsph1 T A 7: 13,450,939 L9* probably null Het
C6 T G 15: 4,755,367 N238K probably benign Het
Cbs T C 17: 31,619,156 D373G probably damaging Het
Clec4a3 T C 6: 122,969,370 F191S possibly damaging Het
Cpz A G 5: 35,503,681 V530A probably damaging Het
Ctsc G T 7: 88,278,342 S47I possibly damaging Het
Cyp7b1 T G 3: 18,103,796 Y53S probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Defb4 T C 8: 19,201,204 I29T probably benign Het
Disc1 A T 8: 125,261,097 probably null Het
Dnah2 A G 11: 69,436,836 M3429T probably damaging Het
Dnah7a A T 1: 53,433,054 I3518N possibly damaging Het
Dnah8 A T 17: 30,871,351 H4609L probably damaging Het
Evi5 C A 5: 107,820,535 C182F probably damaging Het
Fam149b G A 14: 20,363,424 R237H probably damaging Het
Fut8 T A 12: 77,393,762 D174E possibly damaging Het
Ghr T C 15: 3,341,098 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm12794 T C 4: 101,941,584 F251L probably benign Het
Gm8882 T A 6: 132,364,058 Q17L unknown Het
Gm9573 A G 17: 35,622,722 probably benign Het
Gpr176 T C 2: 118,279,708 S357G probably benign Het
Grwd1 A T 7: 45,827,177 probably null Het
H2-T24 A G 17: 36,014,880 V273A possibly damaging Het
Hdac4 A C 1: 91,956,038 probably benign Het
Herc3 A G 6: 58,918,817 T1017A probably damaging Het
Hsd11b1 T C 1: 193,242,168 probably benign Het
Igsf23 T C 7: 19,941,753 S143G probably benign Het
Kbtbd12 T A 6: 88,617,906 Y314F probably damaging Het
Kcnmb2 A G 3: 32,198,359 probably null Het
Kdm5b A G 1: 134,604,522 I479M probably damaging Het
Kidins220 A G 12: 25,008,069 T600A probably damaging Het
Mrgprb2 A C 7: 48,552,329 I216S probably damaging Het
Myo1g A G 11: 6,511,084 probably benign Het
Olfr706 A G 7: 106,886,415 V134A probably benign Het
Olfr921 A T 9: 38,775,239 probably null Het
Olfr943 A G 9: 39,184,684 I169V probably benign Het
Pdia5 A T 16: 35,464,390 S66T possibly damaging Het
Plec T C 15: 76,178,006 E2604G probably damaging Het
Plekha6 G T 1: 133,282,180 A654S probably benign Het
Pnpla2 G A 7: 141,459,520 probably null Het
Prkdc A G 16: 15,736,799 D2128G probably benign Het
Rabggta A T 14: 55,720,811 L131Q probably damaging Het
Rbks A T 5: 31,624,519 Y312* probably null Het
Rnf139 A G 15: 58,899,473 Y449C probably damaging Het
Sbno1 A G 5: 124,386,868 V1058A possibly damaging Het
Sema3a A T 5: 13,557,301 N321I probably damaging Het
Slit3 T A 11: 35,579,101 V310E probably damaging Het
Slitrk5 T C 14: 111,680,824 S627P probably benign Het
Stat2 T A 10: 128,277,867 F172I probably damaging Het
Tchh C A 3: 93,445,616 R788S unknown Het
Tnks T A 8: 34,853,259 K753* probably null Het
Trank1 T A 9: 111,365,353 V815D probably benign Het
Trank1 T A 9: 111,392,940 I2915N probably damaging Het
Trpc6 T C 9: 8,610,343 S271P probably damaging Het
Trpm5 T C 7: 143,086,876 Q213R probably benign Het
Ulk3 C T 9: 57,594,227 probably benign Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Wnt3a A G 11: 59,256,318 S181P probably damaging Het
Yipf3 T C 17: 46,248,312 F22S possibly damaging Het
Zbtb40 A T 4: 136,986,556 H1094Q probably damaging Het
Other mutations in Nrxn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Nrxn3 APN 12 90204592 missense probably damaging 1.00
IGL00961:Nrxn3 APN 12 90204546 missense possibly damaging 0.95
IGL01073:Nrxn3 APN 12 89254740 missense probably benign 0.25
IGL01338:Nrxn3 APN 12 89255034 missense possibly damaging 0.86
IGL01377:Nrxn3 APN 12 89533012 critical splice donor site probably null
IGL01409:Nrxn3 APN 12 89510358 missense probably damaging 1.00
IGL01764:Nrxn3 APN 12 90204750 missense possibly damaging 0.48
IGL02063:Nrxn3 APN 12 88795795 missense possibly damaging 0.86
IGL02171:Nrxn3 APN 12 89193163 missense probably damaging 1.00
IGL02309:Nrxn3 APN 12 89976407 missense probably damaging 0.99
IGL02340:Nrxn3 APN 12 90204628 missense possibly damaging 0.82
IGL02343:Nrxn3 APN 12 88795353 missense probably damaging 1.00
IGL02600:Nrxn3 APN 12 89511912 splice site probably benign
IGL02735:Nrxn3 APN 12 89254854 missense probably benign 0.16
IGL03061:Nrxn3 APN 12 89511928 nonsense probably null
IGL03206:Nrxn3 APN 12 89260508 missense possibly damaging 0.88
IGL03337:Nrxn3 APN 12 89255020 missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89260201 missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89260201 missense probably damaging 1.00
R0144:Nrxn3 UTSW 12 89348392 missense probably damaging 1.00
R0531:Nrxn3 UTSW 12 88795342 missense probably damaging 1.00
R0840:Nrxn3 UTSW 12 90331793 missense possibly damaging 0.68
R1324:Nrxn3 UTSW 12 89254696 missense possibly damaging 0.89
R1438:Nrxn3 UTSW 12 90332135 missense probably damaging 1.00
R1484:Nrxn3 UTSW 12 89254777 missense probably damaging 0.99
R1621:Nrxn3 UTSW 12 88795710 missense probably benign
R1637:Nrxn3 UTSW 12 89354468 missense possibly damaging 0.94
R1659:Nrxn3 UTSW 12 90332391 missense probably damaging 1.00
R1746:Nrxn3 UTSW 12 89255019 missense possibly damaging 0.63
R1801:Nrxn3 UTSW 12 90283582 missense probably damaging 1.00
R1912:Nrxn3 UTSW 12 88795342 missense probably damaging 1.00
R1940:Nrxn3 UTSW 12 89260381 missense probably damaging 0.98
R1993:Nrxn3 UTSW 12 89260411 missense possibly damaging 0.59
R2002:Nrxn3 UTSW 12 90332315 missense probably damaging 1.00
R2125:Nrxn3 UTSW 12 89260520 splice site probably null
R2179:Nrxn3 UTSW 12 89254678 missense probably damaging 1.00
R2207:Nrxn3 UTSW 12 89348312 missense probably damaging 1.00
R2284:Nrxn3 UTSW 12 89510365 missense probably damaging 1.00
R2433:Nrxn3 UTSW 12 89976392 missense probably damaging 1.00
R2969:Nrxn3 UTSW 12 89354471 missense probably damaging 1.00
R3053:Nrxn3 UTSW 12 89255101 missense probably damaging 0.99
R3076:Nrxn3 UTSW 12 89260416 missense probably damaging 1.00
R3078:Nrxn3 UTSW 12 89260416 missense probably damaging 1.00
R4033:Nrxn3 UTSW 12 89533001 missense probably damaging 1.00
R4222:Nrxn3 UTSW 12 89532992 nonsense probably null
R4321:Nrxn3 UTSW 12 90199231 missense probably damaging 1.00
R4470:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4471:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4472:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4686:Nrxn3 UTSW 12 89510651 missense probably damaging 0.99
R4776:Nrxn3 UTSW 12 90331956 missense possibly damaging 0.55
R4821:Nrxn3 UTSW 12 90204709 missense probably damaging 0.99
R4869:Nrxn3 UTSW 12 88795582 missense possibly damaging 0.95
R4910:Nrxn3 UTSW 12 89260360 missense possibly damaging 0.72
R4960:Nrxn3 UTSW 12 88795201 missense possibly damaging 0.79
R4990:Nrxn3 UTSW 12 89260474 missense probably damaging 1.00
R4991:Nrxn3 UTSW 12 89260474 missense probably damaging 1.00
R5057:Nrxn3 UTSW 12 89255034 missense probably damaging 0.99
R5329:Nrxn3 UTSW 12 89813584 missense possibly damaging 0.92
R5888:Nrxn3 UTSW 12 89512085 missense possibly damaging 0.91
R6249:Nrxn3 UTSW 12 89254678 missense probably damaging 1.00
R6264:Nrxn3 UTSW 12 90332237 missense probably damaging 1.00
R6373:Nrxn3 UTSW 12 89976469 missense probably damaging 1.00
R6401:Nrxn3 UTSW 12 89255000 missense possibly damaging 0.46
R6434:Nrxn3 UTSW 12 88795515 missense probably benign 0.32
R6528:Nrxn3 UTSW 12 89513049 missense probably damaging 1.00
R6612:Nrxn3 UTSW 12 89813332 intron probably benign
R6632:Nrxn3 UTSW 12 89193154 missense probably damaging 1.00
R6874:Nrxn3 UTSW 12 90332190 missense probably damaging 0.99
X0019:Nrxn3 UTSW 12 90199221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACCATGCACCTGAGAATCCAC -3'
(R):5'- CTGAGAGCAAGCAGCATTTGCC -3'

Sequencing Primer
(F):5'- CCTGGACGCTTGGGATCTG -3'
(R):5'- GCAGCATTTGCCTGTAAGAG -3'
Posted On2013-04-16