Incidental Mutation 'R2903:Hsp90b1'
ID 261557
Institutional Source Beutler Lab
Gene Symbol Hsp90b1
Ensembl Gene ENSMUSG00000020048
Gene Name heat shock protein 90, beta (Grp94), member 1
Synonyms ERp99, gp96, GRP94, tumor rejection antigen (gp96) 1, Tra-1, endoplasmin, 90 kDa, Targ2, Tra1
MMRRC Submission 040490-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2903 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 86526705-86541308 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 86539349 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 90 (I90S)
Ref Sequence ENSEMBL: ENSMUSP00000020238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020238] [ENSMUST00000061458] [ENSMUST00000075632] [ENSMUST00000217747]
AlphaFold P08113
Predicted Effect probably damaging
Transcript: ENSMUST00000020238
AA Change: I90S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020238
Gene: ENSMUSG00000020048
AA Change: I90S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
HATPase_c 96 255 4.96e-9 SMART
Pfam:HSP90 257 781 2.5e-233 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061458
SMART Domains Protein: ENSMUSP00000062844
Gene: ENSMUSG00000044937

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Blast:AAA 336 401 9e-8 BLAST
SCOP:d1jpna2 338 370 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075632
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174945
Predicted Effect probably benign
Transcript: ENSMUST00000217747
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of adenosine triphosphate(ATP)-metabolizing molecular chaperones with roles in stabilizing and folding other proteins. The encoded protein is localized to melanosomes and the endoplasmic reticulum. Expression of this protein is associated with a variety of pathogenic states, including tumor formation. There is a microRNA gene located within the 5' exon of this gene. There are pseudogenes for this gene on chromosomes 1 and 15. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before somite formation with failure of primitive streak formation, absence of the chorion and amnion, and failure of mesoderm formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik A T 14: 34,233,898 (GRCm39) V131E unknown Het
Ccnk T C 12: 108,168,647 (GRCm39) probably benign Het
Cd276 A G 9: 58,444,603 (GRCm39) F123L probably benign Het
Ddr2 T A 1: 169,825,730 (GRCm39) N290I probably damaging Het
Ecpas A G 4: 58,828,622 (GRCm39) V937A possibly damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,504,945 (GRCm39) probably null Het
Gpt A G 15: 76,582,666 (GRCm39) D37G probably damaging Het
Grik3 T A 4: 125,564,437 (GRCm39) L473Q probably damaging Het
Ift56 T C 6: 38,378,037 (GRCm39) V283A possibly damaging Het
Ing5 G A 1: 93,731,710 (GRCm39) probably benign Het
Kalrn C T 16: 33,810,180 (GRCm39) D2525N possibly damaging Het
Kdr T C 5: 76,127,069 (GRCm39) Y307C probably damaging Het
Or51t4 A T 7: 102,598,661 (GRCm39) M320L probably benign Het
Rapgef5 A G 12: 117,677,854 (GRCm39) K161R probably damaging Het
Rassf10 A T 7: 112,553,756 (GRCm39) D119V possibly damaging Het
Samhd1 A T 2: 156,965,335 (GRCm39) F160Y possibly damaging Het
Sh3bp2 T A 5: 34,700,900 (GRCm39) C34* probably null Het
Six3 A G 17: 85,931,283 (GRCm39) E313G probably damaging Het
Tas2r118 A G 6: 23,969,801 (GRCm39) F87L possibly damaging Het
Tmem131 A G 1: 36,864,378 (GRCm39) L591P probably damaging Het
Trav17 A C 14: 54,044,123 (GRCm39) S10R probably benign Het
Ttll3 T C 6: 113,384,284 (GRCm39) F534S probably damaging Het
Umodl1 T A 17: 31,211,147 (GRCm39) V890E probably damaging Het
Uso1 G A 5: 92,343,294 (GRCm39) probably null Het
Utrn A G 10: 12,519,172 (GRCm39) I2260T probably damaging Het
Vav1 A G 17: 57,613,187 (GRCm39) N620D probably benign Het
Other mutations in Hsp90b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Hsp90b1 APN 10 86,540,234 (GRCm39) missense probably benign 0.40
IGL01671:Hsp90b1 APN 10 86,540,189 (GRCm39) missense probably benign 0.07
IGL01673:Hsp90b1 APN 10 86,529,296 (GRCm39) missense probably damaging 0.99
IGL02097:Hsp90b1 APN 10 86,527,548 (GRCm39) unclassified probably benign
IGL02124:Hsp90b1 APN 10 86,541,222 (GRCm39) unclassified probably benign
IGL02257:Hsp90b1 APN 10 86,534,453 (GRCm39) missense probably damaging 1.00
IGL02339:Hsp90b1 APN 10 86,537,678 (GRCm39) missense probably damaging 1.00
IGL02342:Hsp90b1 APN 10 86,531,603 (GRCm39) critical splice acceptor site probably null
R0329:Hsp90b1 UTSW 10 86,530,019 (GRCm39) missense probably damaging 1.00
R0330:Hsp90b1 UTSW 10 86,530,019 (GRCm39) missense probably damaging 1.00
R0735:Hsp90b1 UTSW 10 86,531,612 (GRCm39) splice site probably benign
R1531:Hsp90b1 UTSW 10 86,532,659 (GRCm39) missense probably benign 0.02
R1540:Hsp90b1 UTSW 10 86,529,906 (GRCm39) missense probably damaging 1.00
R1711:Hsp90b1 UTSW 10 86,530,389 (GRCm39) missense probably damaging 1.00
R1797:Hsp90b1 UTSW 10 86,537,609 (GRCm39) missense possibly damaging 0.86
R2128:Hsp90b1 UTSW 10 86,531,570 (GRCm39) missense probably damaging 1.00
R2129:Hsp90b1 UTSW 10 86,531,570 (GRCm39) missense probably damaging 1.00
R4735:Hsp90b1 UTSW 10 86,529,819 (GRCm39) missense probably damaging 1.00
R4749:Hsp90b1 UTSW 10 86,537,672 (GRCm39) missense probably damaging 1.00
R5011:Hsp90b1 UTSW 10 86,532,617 (GRCm39) missense probably benign 0.37
R5650:Hsp90b1 UTSW 10 86,529,367 (GRCm39) missense probably damaging 1.00
R5950:Hsp90b1 UTSW 10 86,537,609 (GRCm39) missense possibly damaging 0.86
R6731:Hsp90b1 UTSW 10 86,537,769 (GRCm39) missense probably benign 0.01
R6835:Hsp90b1 UTSW 10 86,529,949 (GRCm39) missense probably damaging 1.00
R7038:Hsp90b1 UTSW 10 86,531,730 (GRCm39) missense probably damaging 0.99
R7250:Hsp90b1 UTSW 10 86,527,572 (GRCm39) missense unknown
R7343:Hsp90b1 UTSW 10 86,528,047 (GRCm39) missense probably damaging 1.00
R8027:Hsp90b1 UTSW 10 86,532,594 (GRCm39) missense probably damaging 0.97
R8126:Hsp90b1 UTSW 10 86,530,246 (GRCm39) missense probably damaging 0.99
R8336:Hsp90b1 UTSW 10 86,526,968 (GRCm39) makesense probably null
R8768:Hsp90b1 UTSW 10 86,541,169 (GRCm39) critical splice donor site probably null
R9024:Hsp90b1 UTSW 10 86,541,174 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CAGGGGTACAGTTGTGTGAC -3'
(R):5'- AGTCTGTGTCCTGACTAGAGAC -3'

Sequencing Primer
(F):5'- TCATCCGTCGGTAGGTCATGAC -3'
(R):5'- TCCTGACTAGAGACTGAGAAAAATG -3'
Posted On 2015-01-23