Incidental Mutation 'R2904:Abraxas1'
ID261573
Institutional Source Beutler Lab
Gene Symbol Abraxas1
Ensembl Gene ENSMUSG00000035234
Gene NameBRCA1 A complex subunit
Synonyms3830405G04Rik, Fam175a, Ccdc98, 5630400M01Rik
MMRRC Submission 040491-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R2904 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location100805192-100820965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100809807 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 182 (E182G)
Ref Sequence ENSEMBL: ENSMUSP00000143465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044535] [ENSMUST00000055245] [ENSMUST00000117364] [ENSMUST00000129358] [ENSMUST00000153302] [ENSMUST00000200657]
Predicted Effect probably benign
Transcript: ENSMUST00000044535
AA Change: E182G

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000055245
AA Change: E182G

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000055895
Gene: ENSMUSG00000035234
AA Change: E182G

DomainStartEndE-ValueType
coiled coil region 210 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117364
AA Change: E182G

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114050
Gene: ENSMUSG00000035234
AA Change: E182G

DomainStartEndE-ValueType
coiled coil region 210 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145429
Predicted Effect probably benign
Transcript: ENSMUST00000153302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199779
Predicted Effect probably benign
Transcript: ENSMUST00000200657
AA Change: E182G

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143465
Gene: ENSMUSG00000035234
AA Change: E182G

DomainStartEndE-ValueType
coiled coil region 210 261 N/A INTRINSIC
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the C-terminal repeats of breast cancer 1 (BRCA1) through a phospho-SXXF motif. The encoded protein recruits ubiquitin interaction motif containing 1 protein to BRCA1 protein and is required for DNA damage resistance, DNA repair, and cell cycle checkpoint control. Pseudogenes of this gene are found on chromosomes 3 and 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 C G 12: 84,043,603 T358S probably benign Het
Ap2a2 A G 7: 141,619,478 K433E probably damaging Het
Card11 T A 5: 140,889,133 D592V probably benign Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Crisp1 C T 17: 40,313,004 probably null Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
Fam208b T C 13: 3,582,185 N772S possibly damaging Het
Gak T C 5: 108,624,214 N79S possibly damaging Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Gmpr2 T C 14: 55,672,758 V15A probably damaging Het
Hectd4 T C 5: 121,292,724 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm4b G A 17: 56,355,884 G152S probably benign Het
Kdm6b G A 11: 69,405,785 T552I possibly damaging Het
Kdr T C 5: 75,966,409 Y307C probably damaging Het
Kif11 T C 19: 37,403,655 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd C T 2: 91,175,672 V20M probably damaging Het
Mkrn3 C A 7: 62,418,459 R528L probably benign Het
Myom2 T C 8: 15,098,348 V508A probably benign Het
Nav1 T C 1: 135,585,238 D28G probably benign Het
Nlrp4b T A 7: 10,714,367 W166R probably damaging Het
Olfr113 A T 17: 37,574,814 L203Q possibly damaging Het
Olfr483 T C 7: 108,103,599 Y97H probably benign Het
Rassf10 A T 7: 112,954,549 D119V possibly damaging Het
Smarcc1 A G 9: 110,173,975 N378D possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Trim21 A G 7: 102,559,971 W282R probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Uggt2 T A 14: 119,059,109 Y447F possibly damaging Het
Zfp160 G A 17: 21,025,649 V154I probably benign Het
Other mutations in Abraxas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0658:Abraxas1 UTSW 5 100817961 critical splice donor site probably null
R1591:Abraxas1 UTSW 5 100809639 missense probably benign 0.00
R1779:Abraxas1 UTSW 5 100817956 splice site probably benign
R2421:Abraxas1 UTSW 5 100812174 missense possibly damaging 0.82
R4739:Abraxas1 UTSW 5 100812020 missense probably damaging 1.00
R5563:Abraxas1 UTSW 5 100812174 missense possibly damaging 0.82
R5596:Abraxas1 UTSW 5 100818537 missense probably damaging 1.00
R5631:Abraxas1 UTSW 5 100817974 missense probably damaging 1.00
R5903:Abraxas1 UTSW 5 100817958 splice site probably null
R5983:Abraxas1 UTSW 5 100807911 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCTTGTACAGCAGCATACATTTC -3'
(R):5'- GCTCATCTGGGATGATTCTTGC -3'

Sequencing Primer
(F):5'- TCCATCTTCATTAAAGAACTGAGAAC -3'
(R):5'- GGGATGATTCTTGCTAAATAATGAGG -3'
Posted On2015-01-23