Incidental Mutation 'R2904:Card11'
ID261576
Institutional Source Beutler Lab
Gene Symbol Card11
Ensembl Gene ENSMUSG00000036526
Gene Namecaspase recruitment domain family, member 11
SynonymsCARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
MMRRC Submission 040491-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2904 (G1)
Quality Score165
Status Not validated
Chromosome5
Chromosomal Location140872990-141000582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140889133 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 592 (D592V)
Ref Sequence ENSEMBL: ENSMUSP00000082941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085786]
Predicted Effect probably benign
Transcript: ENSMUST00000085786
AA Change: D592V

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000082941
Gene: ENSMUSG00000036526
AA Change: D592V

DomainStartEndE-ValueType
Pfam:CARD 23 109 1.3e-23 PFAM
coiled coil region 176 440 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
PDZ 674 755 2.73e-1 SMART
Blast:SH3 776 838 1e-10 BLAST
low complexity region 839 850 N/A INTRINSIC
low complexity region 920 934 N/A INTRINSIC
SCOP:d1kjwa2 970 1149 1e-18 SMART
Blast:GuKc 973 1139 1e-102 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 T C 5: 100,809,807 E182G probably benign Het
Acot4 C G 12: 84,043,603 T358S probably benign Het
Ap2a2 A G 7: 141,619,478 K433E probably damaging Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Crisp1 C T 17: 40,313,004 probably null Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
Fam208b T C 13: 3,582,185 N772S possibly damaging Het
Gak T C 5: 108,624,214 N79S possibly damaging Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Gmpr2 T C 14: 55,672,758 V15A probably damaging Het
Hectd4 T C 5: 121,292,724 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm4b G A 17: 56,355,884 G152S probably benign Het
Kdm6b G A 11: 69,405,785 T552I possibly damaging Het
Kdr T C 5: 75,966,409 Y307C probably damaging Het
Kif11 T C 19: 37,403,655 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd C T 2: 91,175,672 V20M probably damaging Het
Mkrn3 C A 7: 62,418,459 R528L probably benign Het
Myom2 T C 8: 15,098,348 V508A probably benign Het
Nav1 T C 1: 135,585,238 D28G probably benign Het
Nlrp4b T A 7: 10,714,367 W166R probably damaging Het
Olfr113 A T 17: 37,574,814 L203Q possibly damaging Het
Olfr483 T C 7: 108,103,599 Y97H probably benign Het
Rassf10 A T 7: 112,954,549 D119V possibly damaging Het
Smarcc1 A G 9: 110,173,975 N378D possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Trim21 A G 7: 102,559,971 W282R probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Uggt2 T A 14: 119,059,109 Y447F possibly damaging Het
Zfp160 G A 17: 21,025,649 V154I probably benign Het
Other mutations in Card11
AlleleSourceChrCoordTypePredicted EffectPPH Score
unmodulated APN 5 140897997 intron probably benign
IGL00961:Card11 APN 5 140899709 missense probably damaging 0.97
IGL01645:Card11 APN 5 140878023 missense probably benign 0.00
IGL01731:Card11 APN 5 140882302 missense possibly damaging 0.89
IGL01782:Card11 APN 5 140927726 start codon destroyed probably null 0.02
IGL01935:Card11 APN 5 140883546 missense possibly damaging 0.62
IGL01991:Card11 APN 5 140913378 missense possibly damaging 0.63
IGL02447:Card11 APN 5 140906924 missense possibly damaging 0.93
IGL02583:Card11 APN 5 140878126 missense probably benign 0.10
IGL03255:Card11 APN 5 140898331 missense possibly damaging 0.73
Dealer UTSW 5 140885877 missense probably damaging 1.00
hubei UTSW 5 140906767 missense probably damaging 0.96
king UTSW 5 140891080 splice site probably benign
may UTSW 5 140876495 nonsense probably null
Sharp UTSW 5 140876425 missense possibly damaging 0.93
Tumnus UTSW 5 140885945 missense possibly damaging 0.75
unmodulated2 UTSW 5 140883782 splice site probably null
R0046:Card11 UTSW 5 140908524 missense possibly damaging 0.92
R0285:Card11 UTSW 5 140887101 missense probably damaging 1.00
R0452:Card11 UTSW 5 140880370 missense probably benign 0.01
R1486:Card11 UTSW 5 140876519 missense probably benign
R1710:Card11 UTSW 5 140902905 nonsense probably null
R1733:Card11 UTSW 5 140906633 missense possibly damaging 0.88
R1817:Card11 UTSW 5 140885560 missense probably benign 0.00
R1818:Card11 UTSW 5 140885560 missense probably benign 0.00
R2027:Card11 UTSW 5 140906767 missense probably damaging 0.96
R2436:Card11 UTSW 5 140882362 missense possibly damaging 0.89
R3706:Card11 UTSW 5 140887135 missense probably damaging 0.99
R3708:Card11 UTSW 5 140887135 missense probably damaging 0.99
R4778:Card11 UTSW 5 140883782 splice site probably null
R4877:Card11 UTSW 5 140885877 missense probably damaging 1.00
R4889:Card11 UTSW 5 140885945 missense possibly damaging 0.75
R4910:Card11 UTSW 5 140874414 missense probably damaging 1.00
R5011:Card11 UTSW 5 140876520 missense possibly damaging 0.93
R5257:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5258:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5682:Card11 UTSW 5 140902911 nonsense probably null
R5754:Card11 UTSW 5 140899769 missense probably damaging 0.99
R5873:Card11 UTSW 5 140908638 missense probably damaging 1.00
R6184:Card11 UTSW 5 140898278 missense probably damaging 1.00
R6792:Card11 UTSW 5 140913309 missense probably damaging 1.00
R6825:Card11 UTSW 5 140878082 missense probably benign
V7732:Card11 UTSW 5 140876495 nonsense probably null
X0067:Card11 UTSW 5 140885592 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- GCTCTGCCTATAAACCACAGAG -3'
(R):5'- AGGGCAGCCTTCCTACTTCC -3'

Sequencing Primer
(F):5'- ACAGAGCCAGCTTAGTCTCTG -3'
(R):5'- GGCAGCCTTCCTACTTCCTTACTTC -3'
Posted On2015-01-23