Incidental Mutation 'R2904:Tas2r118'
ID261577
Institutional Source Beutler Lab
Gene Symbol Tas2r118
Ensembl Gene ENSMUSG00000043865
Gene Nametaste receptor, type 2, member 118
SynonymsmGR18, mt2r40, T2R18, Tas2r18
MMRRC Submission 040491-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R2904 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location23969161-23970060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23969802 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 87 (F87L)
Ref Sequence ENSEMBL: ENSMUSP00000053700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062463]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062463
AA Change: F87L

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053700
Gene: ENSMUSG00000043865
AA Change: F87L

DomainStartEndE-ValueType
Pfam:TAS2R 1 297 4.6e-87 PFAM
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily. These family members are specifically expressed by taste receptor cells of the tongue and palate epithelia. Each of these apparently intronless genes encodes a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered with another 3 candidate taste receptor genes in chromosome 7 and is genetically linked to loci that influence bitter perception. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 T C 5: 100,809,807 E182G probably benign Het
Acot4 C G 12: 84,043,603 T358S probably benign Het
Ap2a2 A G 7: 141,619,478 K433E probably damaging Het
Card11 T A 5: 140,889,133 D592V probably benign Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Crisp1 C T 17: 40,313,004 probably null Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
Fam208b T C 13: 3,582,185 N772S possibly damaging Het
Gak T C 5: 108,624,214 N79S possibly damaging Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Gmpr2 T C 14: 55,672,758 V15A probably damaging Het
Hectd4 T C 5: 121,292,724 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm4b G A 17: 56,355,884 G152S probably benign Het
Kdm6b G A 11: 69,405,785 T552I possibly damaging Het
Kdr T C 5: 75,966,409 Y307C probably damaging Het
Kif11 T C 19: 37,403,655 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd C T 2: 91,175,672 V20M probably damaging Het
Mkrn3 C A 7: 62,418,459 R528L probably benign Het
Myom2 T C 8: 15,098,348 V508A probably benign Het
Nav1 T C 1: 135,585,238 D28G probably benign Het
Nlrp4b T A 7: 10,714,367 W166R probably damaging Het
Olfr113 A T 17: 37,574,814 L203Q possibly damaging Het
Olfr483 T C 7: 108,103,599 Y97H probably benign Het
Rassf10 A T 7: 112,954,549 D119V possibly damaging Het
Smarcc1 A G 9: 110,173,975 N378D possibly damaging Het
Trim21 A G 7: 102,559,971 W282R probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Uggt2 T A 14: 119,059,109 Y447F possibly damaging Het
Zfp160 G A 17: 21,025,649 V154I probably benign Het
Other mutations in Tas2r118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Tas2r118 APN 6 23969747 missense probably damaging 0.99
IGL02517:Tas2r118 APN 6 23969892 missense probably damaging 1.00
IGL03387:Tas2r118 APN 6 23969181 missense possibly damaging 0.71
R0241:Tas2r118 UTSW 6 23969339 missense probably damaging 1.00
R0241:Tas2r118 UTSW 6 23969339 missense probably damaging 1.00
R0544:Tas2r118 UTSW 6 23969401 missense probably damaging 0.97
R1438:Tas2r118 UTSW 6 23969423 missense possibly damaging 0.79
R1471:Tas2r118 UTSW 6 23969171 missense probably damaging 0.96
R1632:Tas2r118 UTSW 6 23969261 missense probably benign 0.21
R2096:Tas2r118 UTSW 6 23969913 missense possibly damaging 0.90
R2106:Tas2r118 UTSW 6 23969570 missense probably benign
R2903:Tas2r118 UTSW 6 23969802 missense possibly damaging 0.87
R2905:Tas2r118 UTSW 6 23969802 missense possibly damaging 0.87
R3798:Tas2r118 UTSW 6 23969823 missense possibly damaging 0.71
R4402:Tas2r118 UTSW 6 23969294 missense probably benign 0.11
R4647:Tas2r118 UTSW 6 23969468 missense probably damaging 1.00
R4707:Tas2r118 UTSW 6 23969226 missense probably benign 0.26
R4965:Tas2r118 UTSW 6 23969628 missense probably benign 0.41
R5114:Tas2r118 UTSW 6 23969210 missense probably benign 0.05
R5823:Tas2r118 UTSW 6 23969471 missense probably benign 0.04
R5834:Tas2r118 UTSW 6 23969877 missense probably benign 0.06
R6976:Tas2r118 UTSW 6 23969471 missense probably benign 0.04
X0062:Tas2r118 UTSW 6 23969440 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGACTAATTCCATCTGGATGTG -3'
(R):5'- CAAAGTTGCACAACGGTTGCAG -3'

Sequencing Primer
(F):5'- TTTAACAACAGAAGGGATGATTGAC -3'
(R):5'- CACAACGGTTGCAGTGCTATTCAG -3'
Posted On2015-01-23