Incidental Mutation 'R2904:Ttc26'
ID261578
Institutional Source Beutler Lab
Gene Symbol Ttc26
Ensembl Gene ENSMUSG00000056832
Gene Nametetratricopeptide repeat domain 26
Synonyms
MMRRC Submission 040491-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock #R2904 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location38381469-38427647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38401102 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 283 (V283A)
Ref Sequence ENSEMBL: ENSMUSP00000124369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159145] [ENSMUST00000160215] [ENSMUST00000162554]
Predicted Effect probably benign
Transcript: ENSMUST00000159145
SMART Domains Protein: ENSMUSP00000124873
Gene: ENSMUSG00000056832

DomainStartEndE-ValueType
low complexity region 19 29 N/A INTRINSIC
Pfam:TPR_2 58 88 1.2e-5 PFAM
Pfam:TPR_8 58 91 1.7e-3 PFAM
Pfam:TPR_1 61 87 4.6e-4 PFAM
Pfam:TPR_11 63 113 4.9e-11 PFAM
Pfam:TPR_19 67 113 3.1e-7 PFAM
Pfam:TPR_8 89 113 2e-3 PFAM
Pfam:TPR_1 91 113 1.7e-4 PFAM
Pfam:TPR_2 91 113 2.4e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160215
SMART Domains Protein: ENSMUSP00000125097
Gene: ENSMUSG00000056832

DomainStartEndE-ValueType
low complexity region 19 29 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162554
AA Change: V283A

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124369
Gene: ENSMUSG00000056832
AA Change: V283A

DomainStartEndE-ValueType
low complexity region 19 29 N/A INTRINSIC
Pfam:TPR_2 58 88 2.7e-5 PFAM
Pfam:TPR_11 63 117 9e-9 PFAM
Pfam:TPR_9 157 227 9.2e-4 PFAM
Blast:TPR 359 392 9e-10 BLAST
Blast:TPR 461 494 8e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162673
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (30/31)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous nonsense mutation exhibit partial prenatal lethality, a hopping gait, preaxial polydactyly, male sterility due to lack of sperm flagella, impaired hearing, and patterning defects that are typical of impaired Hedgehog signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 T C 5: 100,809,807 E182G probably benign Het
Acot4 C G 12: 84,043,603 T358S probably benign Het
Ap2a2 A G 7: 141,619,478 K433E probably damaging Het
Card11 T A 5: 140,889,133 D592V probably benign Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Crisp1 C T 17: 40,313,004 probably null Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
Fam208b T C 13: 3,582,185 N772S possibly damaging Het
Gak T C 5: 108,624,214 N79S possibly damaging Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Gmpr2 T C 14: 55,672,758 V15A probably damaging Het
Hectd4 T C 5: 121,292,724 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm4b G A 17: 56,355,884 G152S probably benign Het
Kdm6b G A 11: 69,405,785 T552I possibly damaging Het
Kdr T C 5: 75,966,409 Y307C probably damaging Het
Kif11 T C 19: 37,403,655 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd C T 2: 91,175,672 V20M probably damaging Het
Mkrn3 C A 7: 62,418,459 R528L probably benign Het
Myom2 T C 8: 15,098,348 V508A probably benign Het
Nav1 T C 1: 135,585,238 D28G probably benign Het
Nlrp4b T A 7: 10,714,367 W166R probably damaging Het
Olfr113 A T 17: 37,574,814 L203Q possibly damaging Het
Olfr483 T C 7: 108,103,599 Y97H probably benign Het
Rassf10 A T 7: 112,954,549 D119V possibly damaging Het
Smarcc1 A G 9: 110,173,975 N378D possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Trim21 A G 7: 102,559,971 W282R probably benign Het
Uggt2 T A 14: 119,059,109 Y447F possibly damaging Het
Zfp160 G A 17: 21,025,649 V154I probably benign Het
Other mutations in Ttc26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Ttc26 APN 6 38382220 splice site probably benign
IGL02049:Ttc26 APN 6 38425132 missense probably benign 0.16
IGL02403:Ttc26 APN 6 38409438 missense possibly damaging 0.95
IGL02902:Ttc26 APN 6 38425162 missense probably benign 0.21
IGL03189:Ttc26 APN 6 38425231 missense probably benign 0.00
IGL03410:Ttc26 APN 6 38385500 missense probably damaging 1.00
R0346:Ttc26 UTSW 6 38409435 missense probably damaging 1.00
R0562:Ttc26 UTSW 6 38401129 missense probably damaging 1.00
R0826:Ttc26 UTSW 6 38425114 splice site probably null
R1212:Ttc26 UTSW 6 38410793 missense probably damaging 1.00
R1778:Ttc26 UTSW 6 38409476 missense possibly damaging 0.93
R1972:Ttc26 UTSW 6 38410803 missense probably benign 0.20
R2903:Ttc26 UTSW 6 38401102 missense possibly damaging 0.61
R2905:Ttc26 UTSW 6 38401102 missense possibly damaging 0.61
R3788:Ttc26 UTSW 6 38403524 critical splice donor site probably null
R4222:Ttc26 UTSW 6 38395075 missense probably damaging 1.00
R4392:Ttc26 UTSW 6 38381557 start gained probably benign
R4930:Ttc26 UTSW 6 38391540 missense probably damaging 1.00
R5484:Ttc26 UTSW 6 38389122 missense probably benign 0.10
R5920:Ttc26 UTSW 6 38412070 missense probably damaging 1.00
R6229:Ttc26 UTSW 6 38395040 missense probably benign 0.22
R6429:Ttc26 UTSW 6 38398313 missense possibly damaging 0.69
R6901:Ttc26 UTSW 6 38401144 missense possibly damaging 0.80
X0066:Ttc26 UTSW 6 38405942 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTTGGTCTAGCCTTGGAC -3'
(R):5'- GCACAACTGGTAAGTGCCATTC -3'

Sequencing Primer
(F):5'- ACTTGGTCTAGCCTTGGACTTACTTG -3'
(R):5'- CAACTGGTAAGTGCCATTCAATTTG -3'
Posted On2015-01-23