Mutagenetix > Incidental Mutations

Incidental Mutation 'R2904:Olfr483'

261582

Institutional Source

Beutler Lab

Gene Symbol

Olfr483

Ensembl Gene

ENSMUSG00000078118

Gene Name

olfactory receptor 483

Synonyms

MOR204-12, GA_x6K02T2PBJ9-10432095-10433042

MMRRC Submission

040491-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R2904 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108100849-108105944 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108103599 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 97 (Y97H)

Ref Sequence

ENSEMBL: ENSMUSP00000150898 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000104917] [ENSMUST00000215159]

Predicted Effect

probably benign
Transcript: ENSMUST00000104917
AA Change: Y97H

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000100517
Gene: ENSMUSG00000078118
AA Change: Y97H

Domain	Start	End	E-Value	Type
Pfam:7tm_4	34	312	1.6e-51	PFAM
Pfam:7tm_1	44	294	2.2e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209740
AA Change: Y97H

Predicted Effect

probably benign
Transcript: ENSMUST00000215159
AA Change: Y97H

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.096

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (30/31)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abraxas1	T	C	5: 100,809,807	E182G	probably benign	Het
Acot4	C	G	12: 84,043,603	T358S	probably benign	Het
Ap2a2	A	G	7: 141,619,478	K433E	probably damaging	Het
Card11	T	A	5: 140,889,133	D592V	probably benign	Het
Col12a1	G	T	9: 79,652,025	S1860R	probably damaging	Het
Crisp1	C	T	17: 40,313,004		probably null	Het
Dzip1l	A	G	9: 99,663,669	E657G	probably damaging	Het
Fam208b	T	C	13: 3,582,185	N772S	possibly damaging	Het
Gak	T	C	5: 108,624,214	N79S	possibly damaging	Het
Gm9791	T	C	3: 34,005,187		noncoding transcript	Het
Gmpr2	T	C	14: 55,672,758	V15A	probably damaging	Het
Hectd4	T	C	5: 121,292,724		probably benign	Het
Kalrn	C	T	16: 33,989,810	D2525N	possibly damaging	Het
Kdm4b	G	A	17: 56,355,884	G152S	probably benign	Het
Kdm6b	G	A	11: 69,405,785	T552I	possibly damaging	Het
Kdr	T	C	5: 75,966,409	Y307C	probably damaging	Het
Kif11	T	C	19: 37,403,655		probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Madd	C	T	2: 91,175,672	V20M	probably damaging	Het
Mkrn3	C	A	7: 62,418,459	R528L	probably benign	Het
Myom2	T	C	8: 15,098,348	V508A	probably benign	Het
Nav1	T	C	1: 135,585,238	D28G	probably benign	Het
Nlrp4b	T	A	7: 10,714,367	W166R	probably damaging	Het
Olfr113	A	T	17: 37,574,814	L203Q	possibly damaging	Het
Rassf10	A	T	7: 112,954,549	D119V	possibly damaging	Het
Smarcc1	A	G	9: 110,173,975	N378D	possibly damaging	Het
Tas2r118	A	G	6: 23,969,802	F87L	possibly damaging	Het
Trim21	A	G	7: 102,559,971	W282R	probably benign	Het
Ttc26	T	C	6: 38,401,102	V283A	possibly damaging	Het
Uggt2	T	A	14: 119,059,109	Y447F	possibly damaging	Het
Zfp160	G	A	17: 21,025,649	V154I	probably benign	Het

Other mutations in Olfr483

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01093:Olfr483	APN	7	108103644	missense	probably benign
IGL03028:Olfr483	APN	7	108104173	missense	probably damaging	0.99
IGL03275:Olfr483	APN	7	108103608	missense	probably damaging	1.00
R0671:Olfr483	UTSW	7	108104156	nonsense	probably null
R1403:Olfr483	UTSW	7	108103615	missense	probably benign	0.06
R1403:Olfr483	UTSW	7	108103615	missense	probably benign	0.06
R1646:Olfr483	UTSW	7	108103591	missense	probably benign	0.03
R1655:Olfr483	UTSW	7	108103464	missense	probably damaging	1.00
R2334:Olfr483	UTSW	7	108103348	missense	probably benign	0.02
R3816:Olfr483	UTSW	7	108103498	missense	possibly damaging	0.90
R3817:Olfr483	UTSW	7	108103498	missense	possibly damaging	0.90
R3818:Olfr483	UTSW	7	108103498	missense	possibly damaging	0.90
R3819:Olfr483	UTSW	7	108103498	missense	possibly damaging	0.90
R5828:Olfr483	UTSW	7	108103798	missense	possibly damaging	0.51
R5949:Olfr483	UTSW	7	108104197	missense	probably damaging	1.00
R6120:Olfr483	UTSW	7	108104133	missense	probably damaging	1.00
R6143:Olfr483	UTSW	7	108104128	missense	probably damaging	0.96
R6505:Olfr483	UTSW	7	108103567	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACTGTGTTTGGCAACCTCAG -3'
(R):5'- TCTATTTGGCCCACAGAAGAG -3'

Sequencing Primer
(F):5'- GTTTGGCAACCTCAGCACCATC -3'
(R):5'- TCTATTTGGCCCACAGAAGAGAAAAG -3'

Posted On

2015-01-23