Incidental Mutation 'R2904:Dzip1l'
ID261588
Institutional Source Beutler Lab
Gene Symbol Dzip1l
Ensembl Gene ENSMUSG00000037784
Gene NameDAZ interacting protein 1-like
Synonyms
MMRRC Submission 040491-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R2904 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location99629496-99669256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99663669 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 657 (E657G)
Ref Sequence ENSEMBL: ENSMUSP00000108507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078367] [ENSMUST00000112884] [ENSMUST00000112885] [ENSMUST00000112886]
Predicted Effect probably benign
Transcript: ENSMUST00000078367
AA Change: E658G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000077475
Gene: ENSMUSG00000037784
AA Change: E658G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 5e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112884
AA Change: E657G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108505
Gene: ENSMUSG00000037784
AA Change: E657G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 9.8e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 621 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112885
AA Change: E658G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000108506
Gene: ENSMUSG00000037784
AA Change: E658G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 9.8e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112886
AA Change: E657G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108507
Gene: ENSMUSG00000037784
AA Change: E657G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 9.8e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 621 N/A INTRINSIC
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 T C 5: 100,809,807 E182G probably benign Het
Acot4 C G 12: 84,043,603 T358S probably benign Het
Ap2a2 A G 7: 141,619,478 K433E probably damaging Het
Card11 T A 5: 140,889,133 D592V probably benign Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Crisp1 C T 17: 40,313,004 probably null Het
Fam208b T C 13: 3,582,185 N772S possibly damaging Het
Gak T C 5: 108,624,214 N79S possibly damaging Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Gmpr2 T C 14: 55,672,758 V15A probably damaging Het
Hectd4 T C 5: 121,292,724 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm4b G A 17: 56,355,884 G152S probably benign Het
Kdm6b G A 11: 69,405,785 T552I possibly damaging Het
Kdr T C 5: 75,966,409 Y307C probably damaging Het
Kif11 T C 19: 37,403,655 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd C T 2: 91,175,672 V20M probably damaging Het
Mkrn3 C A 7: 62,418,459 R528L probably benign Het
Myom2 T C 8: 15,098,348 V508A probably benign Het
Nav1 T C 1: 135,585,238 D28G probably benign Het
Nlrp4b T A 7: 10,714,367 W166R probably damaging Het
Olfr113 A T 17: 37,574,814 L203Q possibly damaging Het
Olfr483 T C 7: 108,103,599 Y97H probably benign Het
Rassf10 A T 7: 112,954,549 D119V possibly damaging Het
Smarcc1 A G 9: 110,173,975 N378D possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Trim21 A G 7: 102,559,971 W282R probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Uggt2 T A 14: 119,059,109 Y447F possibly damaging Het
Zfp160 G A 17: 21,025,649 V154I probably benign Het
Other mutations in Dzip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dzip1l APN 9 99637777 missense probably damaging 0.99
IGL01992:Dzip1l APN 9 99663686 missense probably damaging 1.00
R0276:Dzip1l UTSW 9 99660998 missense probably benign 0.38
R0506:Dzip1l UTSW 9 99663081 missense possibly damaging 0.76
R1469:Dzip1l UTSW 9 99659776 critical splice donor site probably null
R1469:Dzip1l UTSW 9 99659776 critical splice donor site probably null
R2905:Dzip1l UTSW 9 99663669 missense probably damaging 0.99
R2911:Dzip1l UTSW 9 99655602 missense probably benign 0.00
R3106:Dzip1l UTSW 9 99642572 nonsense probably null
R3106:Dzip1l UTSW 9 99647121 missense probably benign 0.00
R4394:Dzip1l UTSW 9 99639854 missense probably damaging 1.00
R4570:Dzip1l UTSW 9 99647168 nonsense probably null
R4579:Dzip1l UTSW 9 99647214 missense probably damaging 1.00
R4695:Dzip1l UTSW 9 99647205 missense probably benign 0.11
R4696:Dzip1l UTSW 9 99663611 missense possibly damaging 0.94
R4748:Dzip1l UTSW 9 99642651 missense probably damaging 0.96
R5063:Dzip1l UTSW 9 99667652 missense probably damaging 1.00
R5747:Dzip1l UTSW 9 99639809 splice site probably null
R6089:Dzip1l UTSW 9 99642684 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GTTTTGCCTGAGAGAGGAGC -3'
(R):5'- CCCAGTGACACATACATGGG -3'

Sequencing Primer
(F):5'- GCAAAGTCTGGCTTTTGAGTATTTC -3'
(R):5'- CCAGTGACACATACATGGGGTAAAAG -3'
Posted On2015-01-23