Incidental Mutation 'R2904:Acot4'
List |< first << previous [record 49 of 1871] next >> last >|
ID261591
Institutional Source Beutler Lab
Gene Symbol Acot4
Ensembl Gene ENSMUSG00000052392
Gene Nameacyl-CoA thioesterase 4
SynonymsB430212I04Rik, Pte2b, PTE-Ib
MMRRC Submission 040491-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R2904 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84038379-84048601 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 84043603 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 358 (T358S)
Ref Sequence ENSEMBL: ENSMUSP00000021652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021652]
Predicted Effect probably benign
Transcript: ENSMUST00000021652
AA Change: T358S

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021652
Gene: ENSMUSG00000052392
AA Change: T358S

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 16 141 3.4e-43 PFAM
low complexity region 148 159 N/A INTRINSIC
Pfam:Abhydrolase_5 162 361 1e-6 PFAM
Pfam:FSH1 193 364 3.5e-5 PFAM
Pfam:BAAT_C 203 412 1.1e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180751
Predicted Effect probably benign
Transcript: ENSMUST00000221229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221860
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 T C 5: 100,809,807 E182G probably benign Het
Ap2a2 A G 7: 141,619,478 K433E probably damaging Het
Card11 T A 5: 140,889,133 D592V probably benign Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Crisp1 C T 17: 40,313,004 probably null Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
Fam208b T C 13: 3,582,185 N772S possibly damaging Het
Gak T C 5: 108,624,214 N79S possibly damaging Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Gmpr2 T C 14: 55,672,758 V15A probably damaging Het
Hectd4 T C 5: 121,292,724 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm4b G A 17: 56,355,884 G152S probably benign Het
Kdm6b G A 11: 69,405,785 T552I possibly damaging Het
Kdr T C 5: 75,966,409 Y307C probably damaging Het
Kif11 T C 19: 37,403,655 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd C T 2: 91,175,672 V20M probably damaging Het
Mkrn3 C A 7: 62,418,459 R528L probably benign Het
Myom2 T C 8: 15,098,348 V508A probably benign Het
Nav1 T C 1: 135,585,238 D28G probably benign Het
Nlrp4b T A 7: 10,714,367 W166R probably damaging Het
Olfr113 A T 17: 37,574,814 L203Q possibly damaging Het
Olfr483 T C 7: 108,103,599 Y97H probably benign Het
Rassf10 A T 7: 112,954,549 D119V possibly damaging Het
Smarcc1 A G 9: 110,173,975 N378D possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Trim21 A G 7: 102,559,971 W282R probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Uggt2 T A 14: 119,059,109 Y447F possibly damaging Het
Zfp160 G A 17: 21,025,649 V154I probably benign Het
Other mutations in Acot4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Acot4 APN 12 84042025 missense probably damaging 0.98
IGL02806:Acot4 APN 12 84041963 missense probably damaging 1.00
IGL02967:Acot4 APN 12 84043461 missense probably benign
R1827:Acot4 UTSW 12 84041938 missense probably damaging 1.00
R2105:Acot4 UTSW 12 84038742 missense probably damaging 1.00
R2509:Acot4 UTSW 12 84041873 missense probably damaging 1.00
R3859:Acot4 UTSW 12 84043444 missense probably benign 0.17
R3904:Acot4 UTSW 12 84043327 unclassified probably null
R4190:Acot4 UTSW 12 84043174 intron probably benign
R4192:Acot4 UTSW 12 84043174 intron probably benign
R4541:Acot4 UTSW 12 84043248 missense probably benign 0.38
R5061:Acot4 UTSW 12 84038701 missense probably benign 0.03
R5682:Acot4 UTSW 12 84038802 missense probably damaging 1.00
R5864:Acot4 UTSW 12 84043404 missense probably benign 0.04
R6818:Acot4 UTSW 12 84042009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGGAGGCTGTGAGAACC -3'
(R):5'- AATCTACCATGTCTGTTACAGGC -3'

Sequencing Primer
(F):5'- CTGTGAGAACCCCAGCATG -3'
(R):5'- ACTACAGTCTACAGGAGGCTCTG -3'
Posted On2015-01-23