Incidental Mutation 'R2904:Olfr113'
ID261599
Institutional Source Beutler Lab
Gene Symbol Olfr113
Ensembl Gene ENSMUSG00000092292
Gene Nameolfactory receptor 113
SynonymsGA_x6K02T2PSCP-2034880-2033942, MOR218-9
MMRRC Submission 040491-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R2904 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37573877-37577663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37574814 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 203 (L203Q)
Ref Sequence ENSEMBL: ENSMUSP00000149739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174139] [ENSMUST00000216181]
Predicted Effect possibly damaging
Transcript: ENSMUST00000174139
AA Change: L203Q

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134080
Gene: ENSMUSG00000109212
AA Change: L203Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.7e-46 PFAM
Pfam:7TM_GPCR_Srx 32 307 3.4e-7 PFAM
Pfam:7TM_GPCR_Srsx 35 305 4.2e-6 PFAM
Pfam:7tm_1 41 290 2.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201362
AA Change: L203Q
Predicted Effect possibly damaging
Transcript: ENSMUST00000216181
AA Change: L203Q

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 T C 5: 100,809,807 E182G probably benign Het
Acot4 C G 12: 84,043,603 T358S probably benign Het
Ap2a2 A G 7: 141,619,478 K433E probably damaging Het
Card11 T A 5: 140,889,133 D592V probably benign Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Crisp1 C T 17: 40,313,004 probably null Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
Fam208b T C 13: 3,582,185 N772S possibly damaging Het
Gak T C 5: 108,624,214 N79S possibly damaging Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Gmpr2 T C 14: 55,672,758 V15A probably damaging Het
Hectd4 T C 5: 121,292,724 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm4b G A 17: 56,355,884 G152S probably benign Het
Kdm6b G A 11: 69,405,785 T552I possibly damaging Het
Kdr T C 5: 75,966,409 Y307C probably damaging Het
Kif11 T C 19: 37,403,655 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd C T 2: 91,175,672 V20M probably damaging Het
Mkrn3 C A 7: 62,418,459 R528L probably benign Het
Myom2 T C 8: 15,098,348 V508A probably benign Het
Nav1 T C 1: 135,585,238 D28G probably benign Het
Nlrp4b T A 7: 10,714,367 W166R probably damaging Het
Olfr483 T C 7: 108,103,599 Y97H probably benign Het
Rassf10 A T 7: 112,954,549 D119V possibly damaging Het
Smarcc1 A G 9: 110,173,975 N378D possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Trim21 A G 7: 102,559,971 W282R probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Uggt2 T A 14: 119,059,109 Y447F possibly damaging Het
Zfp160 G A 17: 21,025,649 V154I probably benign Het
Other mutations in Olfr113
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Olfr113 APN 17 37574917 missense probably damaging 0.98
IGL01061:Olfr113 APN 17 37574904 missense possibly damaging 0.47
IGL01293:Olfr113 APN 17 37575417 missense probably benign
IGL01370:Olfr113 APN 17 37574521 unclassified probably null
IGL01535:Olfr113 APN 17 37574788 missense possibly damaging 0.90
IGL02134:Olfr113 APN 17 37575358 missense probably benign 0.01
IGL02536:Olfr113 APN 17 37574926 missense probably damaging 1.00
IGL02640:Olfr113 APN 17 37575021 missense possibly damaging 0.73
IGL02652:Olfr113 APN 17 37574945 nonsense probably null
IGL02963:Olfr113 APN 17 37574854 missense probably benign 0.09
R0104:Olfr113 UTSW 17 37574926 missense probably damaging 1.00
R1662:Olfr113 UTSW 17 37575273 missense probably damaging 1.00
R5129:Olfr113 UTSW 17 37575180 missense probably damaging 1.00
R5197:Olfr113 UTSW 17 37575220 missense probably benign 0.00
R5347:Olfr113 UTSW 17 37574727 missense probably damaging 0.97
R6044:Olfr113 UTSW 17 37574535 missense probably damaging 0.96
X0062:Olfr113 UTSW 17 37574497 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGTAAAGCAGTTGGAGAGTCTG -3'
(R):5'- ATCATGGGTCCCAGCAAGTG -3'

Sequencing Primer
(F):5'- CTGAGGTTGGGTTTAGATATGCAAAG -3'
(R):5'- TCCCAGCAAGTGTAGGTGG -3'
Posted On2015-01-23