Incidental Mutation 'R2904:Crisp1'
ID261600
Institutional Source Beutler Lab
Gene Symbol Crisp1
Ensembl Gene ENSMUSG00000025431
Gene Namecysteine-rich secretory protein 1
SynonymsAeg1, CRISP-1
MMRRC Submission 040491-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2904 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location40293758-40319207 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 40313004 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026498]
Predicted Effect probably null
Transcript: ENSMUST00000026498
SMART Domains Protein: ENSMUSP00000026498
Gene: ENSMUSG00000025431

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SCP 37 178 1.89e-55 SMART
Pfam:Crisp 190 244 4.4e-22 PFAM
Meta Mutation Damage Score 0.484 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (30/31)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit reduced ability of sperm to fertilize eggs but no reduction in fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 T C 5: 100,809,807 E182G probably benign Het
Acot4 C G 12: 84,043,603 T358S probably benign Het
Ap2a2 A G 7: 141,619,478 K433E probably damaging Het
Card11 T A 5: 140,889,133 D592V probably benign Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
Fam208b T C 13: 3,582,185 N772S possibly damaging Het
Gak T C 5: 108,624,214 N79S possibly damaging Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Gmpr2 T C 14: 55,672,758 V15A probably damaging Het
Hectd4 T C 5: 121,292,724 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm4b G A 17: 56,355,884 G152S probably benign Het
Kdm6b G A 11: 69,405,785 T552I possibly damaging Het
Kdr T C 5: 75,966,409 Y307C probably damaging Het
Kif11 T C 19: 37,403,655 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd C T 2: 91,175,672 V20M probably damaging Het
Mkrn3 C A 7: 62,418,459 R528L probably benign Het
Myom2 T C 8: 15,098,348 V508A probably benign Het
Nav1 T C 1: 135,585,238 D28G probably benign Het
Nlrp4b T A 7: 10,714,367 W166R probably damaging Het
Olfr113 A T 17: 37,574,814 L203Q possibly damaging Het
Olfr483 T C 7: 108,103,599 Y97H probably benign Het
Rassf10 A T 7: 112,954,549 D119V possibly damaging Het
Smarcc1 A G 9: 110,173,975 N378D possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Trim21 A G 7: 102,559,971 W282R probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Uggt2 T A 14: 119,059,109 Y447F possibly damaging Het
Zfp160 G A 17: 21,025,649 V154I probably benign Het
Other mutations in Crisp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02794:Crisp1 APN 17 40313066 missense unknown
IGL03034:Crisp1 APN 17 40307728 missense probably benign 0.11
R0670:Crisp1 UTSW 17 40305110 nonsense probably null
R1672:Crisp1 UTSW 17 40308869 missense possibly damaging 0.93
R2264:Crisp1 UTSW 17 40313074 start codon destroyed probably null
R4672:Crisp1 UTSW 17 40294513 critical splice acceptor site probably null
R5079:Crisp1 UTSW 17 40308976 splice site probably null
R5832:Crisp1 UTSW 17 40301317 splice site probably null
R6051:Crisp1 UTSW 17 40305126 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- ACTTCCTGATTACTACACACTCTGG -3'
(R):5'- ACCTACATTGATTTCAGCTCAGAGC -3'

Sequencing Primer
(F):5'- TAGATTTCTGAGTTCAAGGCCAGCC -3'
(R):5'- CATTTGTAGTTGTGTTTCTCTGAACC -3'
Posted On2015-01-23