Incidental Mutation 'R2904:Kif11'
ID261602
Institutional Source Beutler Lab
Gene Symbol Kif11
Ensembl Gene ENSMUSG00000012443
Gene Namekinesin family member 11
SynonymsEg5, Knsl1, Kifl1
MMRRC Submission 040491-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2904 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location37376403-37421859 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 37403655 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000012587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012587]
Predicted Effect probably benign
Transcript: ENSMUST00000012587
SMART Domains Protein: ENSMUSP00000012587
Gene: ENSMUSG00000012443

DomainStartEndE-ValueType
KISc 15 366 8.21e-180 SMART
Blast:KISc 372 417 1e-16 BLAST
low complexity region 453 465 N/A INTRINSIC
Pfam:Microtub_bind 915 1049 1.2e-44 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that belongs to the kinesin-like protein family. Members of this protein family are known to be involved in various kinds of spindle dynamics. The function of this gene product includes chromosome positioning, centrosome separation and establishing a bipolar spindle during cell mitosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Deletion of Kif11 results in early embryonic lethality of homozygotes, with developmental growth arrest at E3.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 T C 5: 100,809,807 E182G probably benign Het
Acot4 C G 12: 84,043,603 T358S probably benign Het
Ap2a2 A G 7: 141,619,478 K433E probably damaging Het
Card11 T A 5: 140,889,133 D592V probably benign Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Crisp1 C T 17: 40,313,004 probably null Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
Fam208b T C 13: 3,582,185 N772S possibly damaging Het
Gak T C 5: 108,624,214 N79S possibly damaging Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Gmpr2 T C 14: 55,672,758 V15A probably damaging Het
Hectd4 T C 5: 121,292,724 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm4b G A 17: 56,355,884 G152S probably benign Het
Kdm6b G A 11: 69,405,785 T552I possibly damaging Het
Kdr T C 5: 75,966,409 Y307C probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd C T 2: 91,175,672 V20M probably damaging Het
Mkrn3 C A 7: 62,418,459 R528L probably benign Het
Myom2 T C 8: 15,098,348 V508A probably benign Het
Nav1 T C 1: 135,585,238 D28G probably benign Het
Nlrp4b T A 7: 10,714,367 W166R probably damaging Het
Olfr113 A T 17: 37,574,814 L203Q possibly damaging Het
Olfr483 T C 7: 108,103,599 Y97H probably benign Het
Rassf10 A T 7: 112,954,549 D119V possibly damaging Het
Smarcc1 A G 9: 110,173,975 N378D possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Trim21 A G 7: 102,559,971 W282R probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Uggt2 T A 14: 119,059,109 Y447F possibly damaging Het
Zfp160 G A 17: 21,025,649 V154I probably benign Het
Other mutations in Kif11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Kif11 APN 19 37411409 missense possibly damaging 0.82
IGL00785:Kif11 APN 19 37404297 missense probably benign 0.01
IGL00785:Kif11 APN 19 37404298 missense probably damaging 0.99
IGL01586:Kif11 APN 19 37384233 splice site probably benign
IGL01883:Kif11 APN 19 37384343 missense probably benign 0.01
IGL02138:Kif11 APN 19 37384609 missense probably damaging 1.00
IGL03197:Kif11 APN 19 37407027 missense probably benign 0.00
R0027:Kif11 UTSW 19 37406983 splice site probably benign
R0027:Kif11 UTSW 19 37406983 splice site probably benign
R0104:Kif11 UTSW 19 37413215 missense probably benign 0.00
R0254:Kif11 UTSW 19 37411509 missense probably benign 0.00
R0631:Kif11 UTSW 19 37413117 splice site probably benign
R1607:Kif11 UTSW 19 37387200 nonsense probably null
R1895:Kif11 UTSW 19 37387399 missense probably damaging 1.00
R1983:Kif11 UTSW 19 37390776 missense possibly damaging 0.78
R2056:Kif11 UTSW 19 37402212 missense probably benign 0.17
R2158:Kif11 UTSW 19 37410614 missense probably benign
R2291:Kif11 UTSW 19 37407003 missense probably benign
R2300:Kif11 UTSW 19 37411539 missense probably benign 0.01
R2850:Kif11 UTSW 19 37409493 missense probably benign
R3035:Kif11 UTSW 19 37407053 missense possibly damaging 0.92
R3908:Kif11 UTSW 19 37390721 missense probably damaging 1.00
R4319:Kif11 UTSW 19 37384585 missense probably damaging 0.99
R4356:Kif11 UTSW 19 37411435 missense probably benign 0.00
R4469:Kif11 UTSW 19 37416492 missense probably benign 0.05
R4623:Kif11 UTSW 19 37409747 missense probably benign
R4779:Kif11 UTSW 19 37417949 missense probably benign 0.00
R4911:Kif11 UTSW 19 37417937 missense probably benign 0.00
R4980:Kif11 UTSW 19 37387371 nonsense probably null
R5109:Kif11 UTSW 19 37384615 missense possibly damaging 0.81
R5770:Kif11 UTSW 19 37390865 missense probably benign 0.03
R6023:Kif11 UTSW 19 37390710 missense probably damaging 1.00
R6666:Kif11 UTSW 19 37409766 missense probably benign
R6755:Kif11 UTSW 19 37409751 missense probably benign 0.01
R6845:Kif11 UTSW 19 37404117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAGAACGAACTTGACCAGTG -3'
(R):5'- CCCTCTGTGCAAAGAAAACTG -3'

Sequencing Primer
(F):5'- TGACCAGTGTAAATCTGACCTGC -3'
(R):5'- TTTATAGTCCCGTCAAAAATGTACC -3'
Posted On2015-01-23