Incidental Mutation 'R2905:Dusp8'
ID 261617
Institutional Source Beutler Lab
Gene Symbol Dusp8
Ensembl Gene ENSMUSG00000037887
Gene Name dual specificity phosphatase 8
Synonyms Nttp1, 5530400B01Rik
MMRRC Submission 040492-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R2905 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 141633227-141649580 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 141637126 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 234 (K234*)
Ref Sequence ENSEMBL: ENSMUSP00000049414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039926] [ENSMUST00000143661]
AlphaFold O09112
Predicted Effect probably null
Transcript: ENSMUST00000039926
AA Change: K234*
SMART Domains Protein: ENSMUSP00000049414
Gene: ENSMUSG00000037887
AA Change: K234*

DomainStartEndE-ValueType
RHOD 13 135 4.71e-14 SMART
DSPc 160 299 3.6e-69 SMART
low complexity region 334 353 N/A INTRINSIC
low complexity region 360 371 N/A INTRINSIC
low complexity region 405 422 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
low complexity region 488 512 N/A INTRINSIC
low complexity region 546 600 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104221
Predicted Effect probably benign
Transcript: ENSMUST00000143661
SMART Domains Protein: ENSMUSP00000114307
Gene: ENSMUSG00000037887

DomainStartEndE-ValueType
RHOD 13 135 4.71e-14 SMART
Pfam:DSPc 168 231 1.5e-9 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates SAPK/JNK and p38, is expressed predominantly in the adult brain, heart, and skeletal muscle, is localized in the cytoplasm, and is induced by nerve growth factor and insulin. An intronless pseudogene for DUSP8 is present on chromosome 10q11.2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered myocardial fiber morphology, mildly increased cardiac muscle contractility at baseline, and decreased response of heart to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ajap1 C A 4: 153,517,284 (GRCm39) R19L probably benign Het
Alk A C 17: 72,292,489 (GRCm39) S496R probably benign Het
Arhgap15 T C 2: 43,953,798 (GRCm39) F175L probably damaging Het
Col12a1 G T 9: 79,559,307 (GRCm39) S1860R probably damaging Het
Cuedc2 C T 19: 46,321,088 (GRCm39) V15I probably benign Het
Dennd3 T A 15: 73,429,495 (GRCm39) L4Q probably damaging Het
Dzip1l A G 9: 99,545,722 (GRCm39) E657G probably damaging Het
F7 C T 8: 13,084,775 (GRCm39) T267I probably benign Het
Gm9791 T C 3: 34,059,336 (GRCm39) noncoding transcript Het
Hmcn1 A G 1: 150,624,786 (GRCm39) S1040P probably damaging Het
Ift56 T C 6: 38,378,037 (GRCm39) V283A possibly damaging Het
Jtb C G 3: 90,139,799 (GRCm39) P62R probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Ly6m T A 15: 74,751,716 (GRCm39) Y106F probably benign Het
Ly75 A G 2: 60,164,898 (GRCm39) V760A probably benign Het
Nudt4 T G 10: 95,399,571 (GRCm39) K17Q probably benign Het
Or6c217 T C 10: 129,738,269 (GRCm39) I103M possibly damaging Het
Pde4a A T 9: 21,112,645 (GRCm39) T274S probably benign Het
Pou6f1 C T 15: 100,483,839 (GRCm39) V220I probably benign Het
Relch T C 1: 105,619,719 (GRCm39) V316A probably benign Het
Rif1 T C 2: 51,988,516 (GRCm39) S752P probably damaging Het
Ror2 A G 13: 53,286,031 (GRCm39) I73T probably benign Het
Samhd1 A T 2: 156,965,335 (GRCm39) F160Y possibly damaging Het
Tas2r118 A G 6: 23,969,801 (GRCm39) F87L possibly damaging Het
Thop1 T C 10: 80,915,425 (GRCm39) L295P probably damaging Het
Tlr12 A G 4: 128,509,802 (GRCm39) M816T probably damaging Het
Trip12 T C 1: 84,732,064 (GRCm39) N970S probably benign Het
Ttll8 A T 15: 88,798,680 (GRCm39) M685K probably benign Het
Ushbp1 G A 8: 71,840,179 (GRCm39) R491* probably null Het
Other mutations in Dusp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Dusp8 APN 7 141,638,160 (GRCm39) missense probably benign 0.05
IGL02458:Dusp8 APN 7 141,636,484 (GRCm39) missense probably benign 0.28
IGL02931:Dusp8 APN 7 141,636,667 (GRCm39) missense probably benign 0.00
IGL03329:Dusp8 APN 7 141,638,097 (GRCm39) nonsense probably null
R0009:Dusp8 UTSW 7 141,635,791 (GRCm39) unclassified probably benign
R1054:Dusp8 UTSW 7 141,635,804 (GRCm39) unclassified probably benign
R1611:Dusp8 UTSW 7 141,636,694 (GRCm39) missense probably benign 0.04
R1883:Dusp8 UTSW 7 141,638,085 (GRCm39) splice site probably null
R2119:Dusp8 UTSW 7 141,636,298 (GRCm39) missense possibly damaging 0.91
R2326:Dusp8 UTSW 7 141,643,800 (GRCm39) missense probably damaging 1.00
R2698:Dusp8 UTSW 7 141,635,701 (GRCm39) unclassified probably benign
R3849:Dusp8 UTSW 7 141,643,802 (GRCm39) missense probably damaging 1.00
R4921:Dusp8 UTSW 7 141,635,891 (GRCm39) unclassified probably benign
R4942:Dusp8 UTSW 7 141,635,965 (GRCm39) missense possibly damaging 0.85
R5288:Dusp8 UTSW 7 141,643,730 (GRCm39) missense possibly damaging 0.95
R5385:Dusp8 UTSW 7 141,643,730 (GRCm39) missense possibly damaging 0.95
R5386:Dusp8 UTSW 7 141,643,730 (GRCm39) missense possibly damaging 0.95
R6301:Dusp8 UTSW 7 141,636,756 (GRCm39) splice site probably null
R6520:Dusp8 UTSW 7 141,637,418 (GRCm39) missense probably damaging 0.99
R6665:Dusp8 UTSW 7 141,643,842 (GRCm39) missense probably damaging 0.97
R9130:Dusp8 UTSW 7 141,642,155 (GRCm39) missense probably benign 0.12
RF016:Dusp8 UTSW 7 141,636,589 (GRCm39) missense probably benign 0.04
X0064:Dusp8 UTSW 7 141,635,764 (GRCm39) unclassified probably benign
Z1176:Dusp8 UTSW 7 141,643,814 (GRCm39) missense probably damaging 1.00
Z1176:Dusp8 UTSW 7 141,635,680 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAGTCCCCAAGCTCTTGTCG -3'
(R):5'- CTCTATAGGGTGGAAGAGGCTG -3'

Sequencing Primer
(F):5'- AATTTGTACAATCCAAGTGGGTGG -3'
(R):5'- GCTGGCTAGAGGAAGACTAGAC -3'
Posted On 2015-01-23