Incidental Mutation 'R0334:Dach1'
ID26163
Institutional Source Beutler Lab
Gene Symbol Dach1
Ensembl Gene ENSMUSG00000055639
Gene Namedachshund family transcription factor 1
SynonymsDac, E130112M23Rik
MMRRC Submission 038543-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0334 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location97786853-98169765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98168748 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 188 (G188R)
Ref Sequence ENSEMBL: ENSMUSP00000071464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069334] [ENSMUST00000071533]
Predicted Effect probably damaging
Transcript: ENSMUST00000069334
AA Change: G188R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064970
Gene: ENSMUSG00000055639
AA Change: G188R

DomainStartEndE-ValueType
low complexity region 7 53 N/A INTRINSIC
low complexity region 61 97 N/A INTRINSIC
low complexity region 102 156 N/A INTRINSIC
Pfam:Ski_Sno 159 275 4.8e-53 PFAM
low complexity region 318 334 N/A INTRINSIC
low complexity region 443 470 N/A INTRINSIC
SCOP:d1eq1a_ 556 674 1e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000071533
AA Change: G188R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071464
Gene: ENSMUSG00000055639
AA Change: G188R

DomainStartEndE-ValueType
low complexity region 7 53 N/A INTRINSIC
low complexity region 61 97 N/A INTRINSIC
low complexity region 102 156 N/A INTRINSIC
Pfam:Ski_Sno 164 274 6.5e-42 PFAM
low complexity region 318 334 N/A INTRINSIC
low complexity region 495 522 N/A INTRINSIC
SCOP:d1eq1a_ 608 726 6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156684
Meta Mutation Damage Score 0.492 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chromatin-associated protein that associates with other DNA-binding transcription factors to regulate gene expression and cell fate determination during development. The protein contains a Ski domain that is highly conserved from Drosophila to human. Expression of this gene is lost in some forms of metastatic cancer, and is correlated with poor prognosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: In spite of normal gross morphology, mice homozygous for targeted mutations that inactivate this gene die within 1 day of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,617,129 probably benign Het
Aggf1 T C 13: 95,371,597 N87S probably benign Het
Ap2b1 T C 11: 83,367,874 probably benign Het
Arfgef3 A G 10: 18,592,281 Y1724H probably damaging Het
Arhgef10l G A 4: 140,583,926 Q243* probably null Het
Atp8a2 A T 14: 59,691,512 F1031Y probably damaging Het
Bmp8b A G 4: 123,114,760 probably null Het
Brinp2 G T 1: 158,295,585 T37K probably benign Het
Bsph1 T A 7: 13,450,939 L9* probably null Het
C6 T G 15: 4,755,367 N238K probably benign Het
Cbs T C 17: 31,619,156 D373G probably damaging Het
Clec4a3 T C 6: 122,969,370 F191S possibly damaging Het
Cpz A G 5: 35,503,681 V530A probably damaging Het
Ctsc G T 7: 88,278,342 S47I possibly damaging Het
Cyp7b1 T G 3: 18,103,796 Y53S probably damaging Het
Defb4 T C 8: 19,201,204 I29T probably benign Het
Disc1 A T 8: 125,261,097 probably null Het
Dnah2 A G 11: 69,436,836 M3429T probably damaging Het
Dnah7a A T 1: 53,433,054 I3518N possibly damaging Het
Dnah8 A T 17: 30,871,351 H4609L probably damaging Het
Evi5 C A 5: 107,820,535 C182F probably damaging Het
Fam149b G A 14: 20,363,424 R237H probably damaging Het
Fut8 T A 12: 77,393,762 D174E possibly damaging Het
Ghr T C 15: 3,341,098 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm12794 T C 4: 101,941,584 F251L probably benign Het
Gm8882 T A 6: 132,364,058 Q17L unknown Het
Gm9573 A G 17: 35,622,722 probably benign Het
Gpr176 T C 2: 118,279,708 S357G probably benign Het
Grwd1 A T 7: 45,827,177 probably null Het
H2-T24 A G 17: 36,014,880 V273A possibly damaging Het
Hdac4 A C 1: 91,956,038 probably benign Het
Herc3 A G 6: 58,918,817 T1017A probably damaging Het
Hsd11b1 T C 1: 193,242,168 probably benign Het
Igsf23 T C 7: 19,941,753 S143G probably benign Het
Kbtbd12 T A 6: 88,617,906 Y314F probably damaging Het
Kcnmb2 A G 3: 32,198,359 probably null Het
Kdm5b A G 1: 134,604,522 I479M probably damaging Het
Kidins220 A G 12: 25,008,069 T600A probably damaging Het
Mrgprb2 A C 7: 48,552,329 I216S probably damaging Het
Myo1g A G 11: 6,511,084 probably benign Het
Nrxn3 T C 12: 89,813,642 probably null Het
Olfr706 A G 7: 106,886,415 V134A probably benign Het
Olfr921 A T 9: 38,775,239 probably null Het
Olfr943 A G 9: 39,184,684 I169V probably benign Het
Pdia5 A T 16: 35,464,390 S66T possibly damaging Het
Plec T C 15: 76,178,006 E2604G probably damaging Het
Plekha6 G T 1: 133,282,180 A654S probably benign Het
Pnpla2 G A 7: 141,459,520 probably null Het
Prkdc A G 16: 15,736,799 D2128G probably benign Het
Rabggta A T 14: 55,720,811 L131Q probably damaging Het
Rbks A T 5: 31,624,519 Y312* probably null Het
Rnf139 A G 15: 58,899,473 Y449C probably damaging Het
Sbno1 A G 5: 124,386,868 V1058A possibly damaging Het
Sema3a A T 5: 13,557,301 N321I probably damaging Het
Slit3 T A 11: 35,579,101 V310E probably damaging Het
Slitrk5 T C 14: 111,680,824 S627P probably benign Het
Stat2 T A 10: 128,277,867 F172I probably damaging Het
Tchh C A 3: 93,445,616 R788S unknown Het
Tnks T A 8: 34,853,259 K753* probably null Het
Trank1 T A 9: 111,365,353 V815D probably benign Het
Trank1 T A 9: 111,392,940 I2915N probably damaging Het
Trpc6 T C 9: 8,610,343 S271P probably damaging Het
Trpm5 T C 7: 143,086,876 Q213R probably benign Het
Ulk3 C T 9: 57,594,227 probably benign Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Wnt3a A G 11: 59,256,318 S181P probably damaging Het
Yipf3 T C 17: 46,248,312 F22S possibly damaging Het
Zbtb40 A T 4: 136,986,556 H1094Q probably damaging Het
Other mutations in Dach1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Dach1 APN 14 97901422 missense possibly damaging 0.83
IGL01101:Dach1 APN 14 97840204 missense possibly damaging 0.83
IGL02033:Dach1 APN 14 97901429 missense possibly damaging 0.82
IGL02116:Dach1 APN 14 97901423 missense probably damaging 0.98
IGL02583:Dach1 APN 14 97828394
IGL02937:Dach1 APN 14 97915795 critical splice donor site probably null
IGL03120:Dach1 APN 14 97827789 missense probably damaging 1.00
R0016:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0017:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0117:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0336:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0371:Dach1 UTSW 14 97969903 missense probably damaging 0.99
R0511:Dach1 UTSW 14 97901329 missense possibly damaging 0.94
R0538:Dach1 UTSW 14 97903279 missense possibly damaging 0.80
R0799:Dach1 UTSW 14 98168615 missense possibly damaging 0.79
R0928:Dach1 UTSW 14 97915832 missense probably damaging 0.98
R0939:Dach1 UTSW 14 97915924 missense probably damaging 0.99
R1512:Dach1 UTSW 14 97901399 missense probably damaging 0.99
R1646:Dach1 UTSW 14 98169114 missense unknown
R1865:Dach1 UTSW 14 97840209 missense possibly damaging 0.68
R1881:Dach1 UTSW 14 97901396 missense probably benign 0.20
R1909:Dach1 UTSW 14 97901393 missense probably damaging 1.00
R1980:Dach1 UTSW 14 97831341 missense probably damaging 1.00
R2215:Dach1 UTSW 14 98168481 critical splice donor site probably null
R2570:Dach1 UTSW 14 97901411 missense probably benign 0.17
R3924:Dach1 UTSW 14 97915903 missense probably damaging 1.00
R3957:Dach1 UTSW 14 97840109 missense probably damaging 0.99
R4095:Dach1 UTSW 14 97901379 missense possibly damaging 0.92
R4373:Dach1 UTSW 14 97827750 missense possibly damaging 0.94
R5350:Dach1 UTSW 14 97969959 missense probably damaging 1.00
R5428:Dach1 UTSW 14 98169269 missense unknown
R5818:Dach1 UTSW 14 98168684 missense probably damaging 1.00
R6824:Dach1 UTSW 14 98018892 missense possibly damaging 0.81
R6967:Dach1 UTSW 14 97903197 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCCACATTGCACACCACCG -3'
(R):5'- GGCTTTGATCCCTCCGACCCAG -3'

Sequencing Primer
(F):5'- ACCGGCGTGATCTCCAAC -3'
(R):5'- gcgggagcaactgcaac -3'
Posted On2013-04-16