Incidental Mutation 'R2905:2010109I03Rik'
ID261632
Institutional Source Beutler Lab
Gene Symbol 2010109I03Rik
Ensembl Gene ENSMUSG00000063522
Gene NameRIKEN cDNA 2010109I03 gene
Synonyms
MMRRC Submission 040492-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.028) question?
Stock #R2905 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location74876987-74897021 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74879867 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 106 (Y106F)
Ref Sequence ENSEMBL: ENSMUSP00000076264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077004]
Predicted Effect probably benign
Transcript: ENSMUST00000077004
AA Change: Y106F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076264
Gene: ENSMUSG00000063522
AA Change: Y106F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LU 21 100 6.96e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190826
Meta Mutation Damage Score 0.0416 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,691,994 V316A probably benign Het
Ajap1 C A 4: 153,432,827 R19L probably benign Het
Alk A C 17: 71,985,494 S496R probably benign Het
Arhgap15 T C 2: 44,063,786 F175L probably damaging Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Cuedc2 C T 19: 46,332,649 V15I probably benign Het
Dennd3 T A 15: 73,557,646 L4Q probably damaging Het
Dusp8 T A 7: 142,083,389 K234* probably null Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
F7 C T 8: 13,034,775 T267I probably benign Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Hmcn1 A G 1: 150,749,035 S1040P probably damaging Het
Jtb C G 3: 90,232,492 P62R probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ly75 A G 2: 60,334,554 V760A probably benign Het
Nudt4 T G 10: 95,563,709 K17Q probably benign Het
Olfr815 T C 10: 129,902,400 I103M possibly damaging Het
Pde4a A T 9: 21,201,349 T274S probably benign Het
Pou6f1 C T 15: 100,585,958 V220I probably benign Het
Rif1 T C 2: 52,098,504 S752P probably damaging Het
Ror2 A G 13: 53,131,995 I73T probably benign Het
Samhd1 A T 2: 157,123,415 F160Y possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Thop1 T C 10: 81,079,591 L295P probably damaging Het
Tlr12 A G 4: 128,616,009 M816T probably damaging Het
Trip12 T C 1: 84,754,343 N970S probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Ttll8 A T 15: 88,914,477 M685K probably benign Het
Ushbp1 G A 8: 71,387,535 R491* probably null Het
Other mutations in 2010109I03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:2010109I03Rik APN 15 74879900 missense probably benign
IGL02550:2010109I03Rik APN 15 74880755 missense probably damaging 1.00
IGL02555:2010109I03Rik APN 15 74881608 splice site probably benign
R3547:2010109I03Rik UTSW 15 74881614 missense probably null 0.96
R4777:2010109I03Rik UTSW 15 74880683 missense probably benign
R6432:2010109I03Rik UTSW 15 74879964 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCTCTATCAGCCACATCTG -3'
(R):5'- CTTTGAACTGGAGGCTGCAG -3'

Sequencing Primer
(F):5'- GCATGATGGCACCAAACT -3'
(R):5'- GGACTCAGTAAATGACCCTCTTC -3'
Posted On2015-01-23