Incidental Mutation 'R2906:Lax1'
ID261639
Institutional Source Beutler Lab
Gene Symbol Lax1
Ensembl Gene ENSMUSG00000051998
Gene Namelymphocyte transmembrane adaptor 1
SynonymsE430019B13Rik
MMRRC Submission 040493-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R2906 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location133679091-133690108 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 133688905 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000131126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169295] [ENSMUST00000189524]
Predicted Effect probably null
Transcript: ENSMUST00000169295
AA Change: M1K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131126
Gene: ENSMUSG00000051998
AA Change: M1K

DomainStartEndE-ValueType
Pfam:LAX 27 378 2.4e-172 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000189524
AA Change: M1K
Meta Mutation Damage Score 0.654 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (37/38)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit spontaneous germinal center formation and increased IgG1, IgG2a, and IgE levels. T and B cells are hyperresponsive upon engagement of T or B AgRs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Adgrg6 A G 10: 14,432,950 I800T probably benign Het
Afg3l2 G A 18: 67,440,222 T170M probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Cd96 T C 16: 46,051,487 T432A possibly damaging Het
Col13a1 T C 10: 61,860,488 probably benign Het
Ddx4 G T 13: 112,620,777 probably benign Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Duoxa1 C T 2: 122,304,674 V197M probably benign Het
Gm6430 A T 1: 97,024,829 noncoding transcript Het
Gtf2a1l G A 17: 88,694,655 R313H possibly damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Lce1k T C 3: 92,806,575 S101G unknown Het
Med12l T C 3: 59,257,082 L1365P probably damaging Het
Mtx2 T C 2: 74,866,909 S83P probably damaging Het
Naip2 A C 13: 100,161,996 C511G probably damaging Het
Nefh A G 11: 4,940,216 I801T probably benign Het
Olfr938 A G 9: 39,078,373 V124A probably benign Het
Oxct2b A G 4: 123,117,030 I248V probably benign Het
Pcdhgb2 A T 18: 37,690,855 I300F probably damaging Het
Ptprc G A 1: 138,064,534 A1285V possibly damaging Het
Rassf3 A G 10: 121,414,392 L172P probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Rpusd1 T C 17: 25,730,731 S292P probably benign Het
Scamp5 A G 9: 57,443,863 V172A probably damaging Het
Snx25 T C 8: 46,049,523 probably null Het
Tmprss11g A G 5: 86,492,802 probably benign Het
Ttll3 G C 6: 113,392,510 probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Usp45 T A 4: 21,834,338 Y805* probably null Het
Zfp639 T C 3: 32,519,751 L175P probably damaging Het
Zfp995 T C 17: 21,880,266 D329G probably benign Het
Other mutations in Lax1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Lax1 APN 1 133680399 missense probably benign 0.09
IGL01568:Lax1 APN 1 133680300 missense probably benign 0.00
IGL02352:Lax1 APN 1 133680470 missense possibly damaging 0.95
IGL02359:Lax1 APN 1 133680470 missense possibly damaging 0.95
IGL02449:Lax1 APN 1 133680136 missense probably damaging 0.98
yon UTSW 1 133683036 missense probably benign 0.20
R0391:Lax1 UTSW 1 133680066 missense probably benign 0.24
R1728:Lax1 UTSW 1 133679978 missense probably benign
R1728:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1728:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1729:Lax1 UTSW 1 133679978 missense probably benign
R1729:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1729:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1730:Lax1 UTSW 1 133679978 missense probably benign
R1730:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1730:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1739:Lax1 UTSW 1 133679978 missense probably benign
R1739:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1739:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1762:Lax1 UTSW 1 133679978 missense probably benign
R1762:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1762:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1783:Lax1 UTSW 1 133679978 missense probably benign
R1783:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1783:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1784:Lax1 UTSW 1 133679978 missense probably benign
R1784:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1784:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1785:Lax1 UTSW 1 133679978 missense probably benign
R1785:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1785:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R2254:Lax1 UTSW 1 133680233 missense probably damaging 0.99
R2912:Lax1 UTSW 1 133684053 missense possibly damaging 0.77
R4022:Lax1 UTSW 1 133683036 missense probably benign 0.20
R5234:Lax1 UTSW 1 133680583 missense probably benign 0.02
R5686:Lax1 UTSW 1 133680176 missense probably damaging 1.00
R5695:Lax1 UTSW 1 133680578 missense probably damaging 1.00
R6003:Lax1 UTSW 1 133684096 missense probably benign 0.24
R6362:Lax1 UTSW 1 133680596 missense possibly damaging 0.92
R6493:Lax1 UTSW 1 133679792 missense probably benign
R6494:Lax1 UTSW 1 133680448 missense probably damaging 0.99
R6932:Lax1 UTSW 1 133680158 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TTGCTCATCTTGGTGGACCC -3'
(R):5'- TGTGAGAACCTTGGTGAATATGATC -3'

Sequencing Primer
(F):5'- TCATCTTGGTGGACCCAGGTC -3'
(R):5'- AGAACCACCTTCATGAGTGCGG -3'
Posted On2015-01-23