Incidental Mutation 'R2906:Ap1b1'
ID261665
Institutional Source Beutler Lab
Gene Symbol Ap1b1
Ensembl Gene ENSMUSG00000009090
Gene Nameadaptor protein complex AP-1, beta 1 subunit
SynonymsAdtb1, beta-prime adaptin
MMRRC Submission 040493-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.663) question?
Stock #R2906 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location4986824-5042791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5031641 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 516 (N516K)
Ref Sequence ENSEMBL: ENSMUSP00000009234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009234] [ENSMUST00000101613] [ENSMUST00000109897]
Predicted Effect probably damaging
Transcript: ENSMUST00000009234
AA Change: N516K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009234
Gene: ENSMUSG00000009090
AA Change: N516K

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 1.5e-174 PFAM
Pfam:HEAT_2 88 157 3.2e-8 PFAM
Pfam:Cnd1 99 268 4.1e-41 PFAM
low complexity region 594 616 N/A INTRINSIC
low complexity region 626 638 N/A INTRINSIC
low complexity region 657 670 N/A INTRINSIC
low complexity region 674 686 N/A INTRINSIC
Alpha_adaptinC2 713 823 3.38e-18 SMART
B2-adapt-app_C 832 942 4.6e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101613
AA Change: N489K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099134
Gene: ENSMUSG00000009090
AA Change: N489K

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 179 7.5e-61 PFAM
Pfam:HEAT_2 88 179 2e-9 PFAM
Pfam:Cnd1 99 176 2.4e-19 PFAM
Pfam:Cnd1 174 241 1.9e-10 PFAM
Pfam:Adaptin_N 176 507 3.8e-102 PFAM
low complexity region 567 589 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 654 666 N/A INTRINSIC
Alpha_adaptinC2 693 803 3.38e-18 SMART
B2-adapt-app_C 812 922 4.6e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109897
AA Change: N489K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105523
Gene: ENSMUSG00000009090
AA Change: N489K

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 179 1.2e-60 PFAM
Pfam:HEAT_2 88 185 3.9e-10 PFAM
Pfam:Cnd1 99 175 5e-20 PFAM
Pfam:Cnd1 174 241 1.7e-7 PFAM
Pfam:Adaptin_N 176 507 4.9e-102 PFAM
low complexity region 567 589 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
Alpha_adaptinC2 686 796 3.38e-18 SMART
B2-adapt-app_C 805 915 4.6e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145704
Meta Mutation Damage Score 0.0328 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 1 is found at the cytoplasmic face of coated vesicles located at the Golgi complex, where it mediates both the recruitment of clathrin to the membrane and the recognition of sorting signals within the cytosolic tails of transmembrane receptors. This complex is a heterotetramer composed of two large, one medium, and one small adaptin subunit. The protein encoded by this gene serves as one of the large subunits of this complex and is a member of the adaptin protein family. This gene is a candidate meningioma gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Adgrg6 A G 10: 14,432,950 I800T probably benign Het
Afg3l2 G A 18: 67,440,222 T170M probably damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Cd96 T C 16: 46,051,487 T432A possibly damaging Het
Col13a1 T C 10: 61,860,488 probably benign Het
Ddx4 G T 13: 112,620,777 probably benign Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Duoxa1 C T 2: 122,304,674 V197M probably benign Het
Gm6430 A T 1: 97,024,829 noncoding transcript Het
Gtf2a1l G A 17: 88,694,655 R313H possibly damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Lax1 A T 1: 133,688,905 M1K probably null Het
Lce1k T C 3: 92,806,575 S101G unknown Het
Med12l T C 3: 59,257,082 L1365P probably damaging Het
Mtx2 T C 2: 74,866,909 S83P probably damaging Het
Naip2 A C 13: 100,161,996 C511G probably damaging Het
Nefh A G 11: 4,940,216 I801T probably benign Het
Olfr938 A G 9: 39,078,373 V124A probably benign Het
Oxct2b A G 4: 123,117,030 I248V probably benign Het
Pcdhgb2 A T 18: 37,690,855 I300F probably damaging Het
Ptprc G A 1: 138,064,534 A1285V possibly damaging Het
Rassf3 A G 10: 121,414,392 L172P probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Rpusd1 T C 17: 25,730,731 S292P probably benign Het
Scamp5 A G 9: 57,443,863 V172A probably damaging Het
Snx25 T C 8: 46,049,523 probably null Het
Tmprss11g A G 5: 86,492,802 probably benign Het
Ttll3 G C 6: 113,392,510 probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Usp45 T A 4: 21,834,338 Y805* probably null Het
Zfp639 T C 3: 32,519,751 L175P probably damaging Het
Zfp995 T C 17: 21,880,266 D329G probably benign Het
Other mutations in Ap1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Ap1b1 APN 11 5019433 missense probably damaging 1.00
IGL01843:Ap1b1 APN 11 5039169 missense probably damaging 1.00
IGL01981:Ap1b1 APN 11 5019336 missense possibly damaging 0.84
IGL02055:Ap1b1 APN 11 5024452 nonsense probably null
IGL02318:Ap1b1 APN 11 5019294 missense probably benign 0.14
IGL02505:Ap1b1 APN 11 5031700 missense probably benign 0.11
IGL02824:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
IGL02825:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
IGL02963:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
PIT4142001:Ap1b1 UTSW 11 5040360 missense probably damaging 1.00
R0321:Ap1b1 UTSW 11 5032464 missense probably benign
R0477:Ap1b1 UTSW 11 5031787 missense probably benign 0.13
R0622:Ap1b1 UTSW 11 5037707 missense probably damaging 0.96
R0831:Ap1b1 UTSW 11 5023092 splice site probably benign
R1502:Ap1b1 UTSW 11 5040290 missense probably benign
R1529:Ap1b1 UTSW 11 5039547 missense probably damaging 1.00
R2110:Ap1b1 UTSW 11 5015613 missense probably damaging 0.99
R2112:Ap1b1 UTSW 11 5015613 missense probably damaging 0.99
R2186:Ap1b1 UTSW 11 5015737 missense possibly damaging 0.84
R2907:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R2908:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R3154:Ap1b1 UTSW 11 5023135 missense possibly damaging 0.95
R3611:Ap1b1 UTSW 11 5024427 missense possibly damaging 0.87
R3805:Ap1b1 UTSW 11 5033225 intron probably null
R4207:Ap1b1 UTSW 11 5031637 missense probably damaging 0.96
R4660:Ap1b1 UTSW 11 5016760 missense probably damaging 1.00
R4710:Ap1b1 UTSW 11 5031664 missense probably damaging 0.97
R4826:Ap1b1 UTSW 11 5018043 missense probably benign 0.11
R4914:Ap1b1 UTSW 11 5024400 missense possibly damaging 0.73
R5086:Ap1b1 UTSW 11 5018020 missense possibly damaging 0.83
R5249:Ap1b1 UTSW 11 5026364 missense probably damaging 0.97
R6014:Ap1b1 UTSW 11 5019364 missense possibly damaging 0.55
R6268:Ap1b1 UTSW 11 5019493 missense probably damaging 1.00
R6388:Ap1b1 UTSW 11 5026319 missense probably damaging 1.00
R6765:Ap1b1 UTSW 11 5019427 missense probably damaging 1.00
R6913:Ap1b1 UTSW 11 5012972 missense possibly damaging 0.84
R7012:Ap1b1 UTSW 11 5030963 missense probably damaging 1.00
R7107:Ap1b1 UTSW 11 5039558 missense probably benign 0.02
X0018:Ap1b1 UTSW 11 5009581 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGGTTTGAAAGCCAAC -3'
(R):5'- TTGTGGTAGACAGAGGCCAG -3'

Sequencing Primer
(F):5'- GCAGAGCTCTGAGTTCAAAGTC -3'
(R):5'- CAGCGTGCCAATGTAGCAG -3'
Posted On2015-01-23