Mutagenetix > Incidental Mutation

Incidental Mutation 'R2907:Astn2'

261683

Institutional Source

Beutler Lab

Gene Symbol

Astn2

Ensembl Gene

ENSMUSG00000028373

Gene Name

astrotactin 2

Synonyms

1d8, Astnl

MMRRC Submission

040494-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R2907 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65299040-66322774 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65563093 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 844 (I844T)

Ref Sequence

ENSEMBL: ENSMUSP00000081540 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068214] [ENSMUST00000084496]

AlphaFold

Q80Z10

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068214
AA Change: I896T

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373
AA Change: I896T

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	87	127	N/A	INTRINSIC
transmembrane domain	219	241	N/A	INTRINSIC
low complexity region	303	312	N/A	INTRINSIC
low complexity region	342	361	N/A	INTRINSIC
low complexity region	393	404	N/A	INTRINSIC
low complexity region	432	437	N/A	INTRINSIC
transmembrane domain	443	465	N/A	INTRINSIC
EGF_like	526	563	2.92e1	SMART
Blast:EGF_like	667	708	2e-18	BLAST
EGF_like	715	764	4.03e1	SMART
MACPF	864	1048	2.88e-55	SMART
FN3	1079	1191	2.41e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084496
AA Change: I844T

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373
AA Change: I844T

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	87	127	N/A	INTRINSIC
transmembrane domain	219	241	N/A	INTRINSIC
low complexity region	303	312	N/A	INTRINSIC
low complexity region	341	352	N/A	INTRINSIC
low complexity region	380	385	N/A	INTRINSIC
transmembrane domain	391	413	N/A	INTRINSIC
EGF_like	474	511	2.92e1	SMART
Blast:EGF_like	615	656	2e-18	BLAST
EGF_like	663	712	4.03e1	SMART
MACPF	812	996	2.88e-55	SMART
FN3	1027	1139	2.41e0	SMART

Meta Mutation Damage Score

0.0701

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl6b	A	G	5: 137,565,559 (GRCm39)	E385G	probably damaging	Het
Adam32	A	T	8: 25,353,520 (GRCm39)	W690R	probably damaging	Het
Ap1b1	T	A	11: 4,981,641 (GRCm39)	N516K	probably damaging	Het
Arap3	G	A	18: 38,123,580 (GRCm39)	P452L	possibly damaging	Het
Armcx6	A	T	X: 133,650,199 (GRCm39)	C211S	probably damaging	Het
Asns	A	G	6: 7,675,506 (GRCm39)	S499P	probably benign	Het
Aspn	G	T	13: 49,705,374 (GRCm39)	V79F	probably damaging	Het
Asxl3	A	T	18: 22,650,330 (GRCm39)	H773L	possibly damaging	Het
Atp7b	G	A	8: 22,501,570 (GRCm39)	T781I	probably damaging	Het
Bcl6	G	A	16: 23,786,869 (GRCm39)	R641W	probably damaging	Het
Csmd3	T	A	15: 47,874,449 (GRCm39)	I612F	probably damaging	Het
Dnm1l	A	T	16: 16,132,175 (GRCm39)	S666T	probably damaging	Het
Gucy2c	A	T	6: 136,685,385 (GRCm39)	V852E	probably damaging	Het
H2-T3	G	A	17: 36,498,347 (GRCm39)	R233C	possibly damaging	Het
Igfbp4	A	G	11: 98,932,377 (GRCm39)		probably benign	Het
Igkv16-104	T	C	6: 68,402,911 (GRCm39)	I68T	probably damaging	Het
Kansl1	T	A	11: 104,315,286 (GRCm39)	S251C	possibly damaging	Het
Kcnk1	G	T	8: 126,722,538 (GRCm39)	V114L	probably benign	Het
Klra3	G	T	6: 130,310,302 (GRCm39)	Q73K	probably damaging	Het
Mcpt1	T	C	14: 56,257,580 (GRCm39)	V242A	probably damaging	Het
Nek10	C	A	14: 14,980,613 (GRCm38)	Q990K	possibly damaging	Het
Nlrp4d	A	T	7: 10,112,354 (GRCm39)	V605E	probably benign	Het
Or10w1	C	T	19: 13,632,611 (GRCm39)	P268S	possibly damaging	Het
Or5an1b	T	C	19: 12,300,032 (GRCm39)	D53G	probably damaging	Het
Or5d46	T	C	2: 88,170,827 (GRCm39)	I306T	probably benign	Het
Osbpl1a	A	G	18: 13,004,129 (GRCm39)		probably benign	Het
Otud4	T	A	8: 80,399,697 (GRCm39)	S803T	probably benign	Het
Pax9	C	T	12: 56,756,529 (GRCm39)	T289I	probably benign	Het
Pcdha5	A	C	18: 37,093,868 (GRCm39)	I126L	possibly damaging	Het
Psmd4	G	T	3: 94,941,273 (GRCm39)	A55E	probably damaging	Het
Rab36	G	A	10: 74,880,328 (GRCm39)	V63I	probably damaging	Het
Rbm26	T	A	14: 105,380,270 (GRCm39)	T516S	probably benign	Het
Sdr42e1	G	A	8: 118,389,511 (GRCm39)	L377F	probably damaging	Het
Setdb1	T	C	3: 95,234,512 (GRCm39)		probably benign	Het
Uba3	T	C	6: 97,180,514 (GRCm39)	E21G	probably benign	Het
Uggt2	C	T	14: 119,256,919 (GRCm39)	S1105N	probably benign	Het
Zfp113	T	C	5: 138,143,219 (GRCm39)	N344D	probably benign	Het
Zfp738	T	C	13: 67,818,231 (GRCm39)	I587V	probably benign	Het

Other mutations in Astn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00964:Astn2	APN	4	66,103,424 (GRCm39)	missense	unknown
IGL01657:Astn2	APN	4	65,570,186 (GRCm39)	missense	probably damaging	0.99
IGL01747:Astn2	APN	4	65,712,855 (GRCm39)	missense	probably benign	0.17
IGL02008:Astn2	APN	4	65,977,390 (GRCm39)	missense	probably damaging	1.00
IGL02215:Astn2	APN	4	66,184,471 (GRCm39)	missense	unknown
IGL02484:Astn2	APN	4	65,910,516 (GRCm39)	splice site	probably benign
IGL02494:Astn2	APN	4	65,910,585 (GRCm39)	missense	probably benign	0.23
IGL02792:Astn2	APN	4	65,563,058 (GRCm39)	missense	probably benign	0.32
IGL03248:Astn2	APN	4	65,664,530 (GRCm39)	splice site	probably benign
IGL03409:Astn2	APN	4	65,353,423 (GRCm39)	missense	possibly damaging	0.46
B6584:Astn2	UTSW	4	65,910,624 (GRCm39)	missense	probably damaging	0.99
R0015:Astn2	UTSW	4	66,184,619 (GRCm39)	critical splice acceptor site	probably null
R0015:Astn2	UTSW	4	66,184,619 (GRCm39)	critical splice acceptor site	probably null
R0092:Astn2	UTSW	4	66,322,219 (GRCm39)	missense	unknown
R0245:Astn2	UTSW	4	65,712,795 (GRCm39)	missense	probably damaging	0.99
R0528:Astn2	UTSW	4	65,563,119 (GRCm39)	splice site	probably benign
R0586:Astn2	UTSW	4	66,103,379 (GRCm39)	missense	unknown
R0652:Astn2	UTSW	4	65,712,795 (GRCm39)	missense	probably damaging	0.99
R0880:Astn2	UTSW	4	65,566,567 (GRCm39)	missense	probably damaging	0.99
R0931:Astn2	UTSW	4	65,566,530 (GRCm39)	missense	probably damaging	0.99
R1353:Astn2	UTSW	4	66,184,572 (GRCm39)	missense	unknown
R1700:Astn2	UTSW	4	65,664,591 (GRCm39)	nonsense	probably null
R1934:Astn2	UTSW	4	65,353,426 (GRCm39)	missense	probably damaging	0.99
R2017:Astn2	UTSW	4	65,459,178 (GRCm39)	missense	probably damaging	0.99
R2101:Astn2	UTSW	4	65,499,923 (GRCm39)	nonsense	probably null
R2158:Astn2	UTSW	4	66,322,491 (GRCm39)	missense	unknown
R2923:Astn2	UTSW	4	65,832,010 (GRCm39)	missense	probably damaging	1.00
R2938:Astn2	UTSW	4	65,910,550 (GRCm39)	missense	possibly damaging	0.92
R3033:Astn2	UTSW	4	65,562,943 (GRCm39)	missense	probably damaging	1.00
R3933:Astn2	UTSW	4	66,322,192 (GRCm39)	missense	unknown
R4151:Astn2	UTSW	4	65,647,557 (GRCm39)	critical splice donor site	probably null
R4230:Astn2	UTSW	4	65,829,919 (GRCm39)	missense	probably damaging	0.99
R4497:Astn2	UTSW	4	66,037,300 (GRCm39)	intron	probably benign
R4717:Astn2	UTSW	4	65,562,991 (GRCm39)	missense	possibly damaging	0.86
R4844:Astn2	UTSW	4	65,562,967 (GRCm39)	missense	possibly damaging	0.90
R4928:Astn2	UTSW	4	65,647,644 (GRCm39)	missense	probably damaging	0.98
R5374:Astn2	UTSW	4	65,315,242 (GRCm39)	missense	probably damaging	0.96
R5442:Astn2	UTSW	4	65,500,023 (GRCm39)	missense	possibly damaging	0.86
R5694:Astn2	UTSW	4	65,868,375 (GRCm39)	missense	probably damaging	1.00
R5756:Astn2	UTSW	4	66,037,425 (GRCm39)	intron	probably benign
R5763:Astn2	UTSW	4	65,647,568 (GRCm39)	missense	probably benign	0.14
R6089:Astn2	UTSW	4	65,712,810 (GRCm39)	missense	probably damaging	0.96
R6990:Astn2	UTSW	4	65,910,540 (GRCm39)	missense	possibly damaging	0.82
R7304:Astn2	UTSW	4	66,103,612 (GRCm39)	missense	unknown
R7325:Astn2	UTSW	4	65,460,906 (GRCm39)	missense	probably benign	0.33
R7356:Astn2	UTSW	4	66,103,503 (GRCm39)	missense	unknown
R7414:Astn2	UTSW	4	65,459,193 (GRCm39)	missense	possibly damaging	0.85
R7755:Astn2	UTSW	4	65,712,795 (GRCm39)	missense	probably damaging	0.99
R7887:Astn2	UTSW	4	65,563,103 (GRCm39)	missense	possibly damaging	0.51
R8027:Astn2	UTSW	4	65,459,208 (GRCm39)	missense	possibly damaging	0.86
R8046:Astn2	UTSW	4	66,184,587 (GRCm39)	nonsense	probably null
R8188:Astn2	UTSW	4	65,977,418 (GRCm39)	missense	unknown
R8271:Astn2	UTSW	4	65,910,663 (GRCm39)	missense	unknown
R8274:Astn2	UTSW	4	65,570,098 (GRCm39)	critical splice donor site	probably null
R8505:Astn2	UTSW	4	65,299,825 (GRCm39)	missense	unknown
R8815:Astn2	UTSW	4	65,830,834 (GRCm39)	missense	possibly damaging	0.96
R8989:Astn2	UTSW	4	65,499,890 (GRCm39)	missense	possibly damaging	0.53
R9013:Astn2	UTSW	4	65,910,584 (GRCm39)	missense	probably benign	0.23
R9127:Astn2	UTSW	4	66,322,164 (GRCm39)	missense	unknown
R9255:Astn2	UTSW	4	65,563,085 (GRCm39)	nonsense	probably null
R9297:Astn2	UTSW	4	65,460,960 (GRCm39)	missense	possibly damaging	0.85
R9320:Astn2	UTSW	4	66,322,386 (GRCm39)	missense	unknown
R9349:Astn2	UTSW	4	66,184,492 (GRCm39)	missense	unknown
R9399:Astn2	UTSW	4	65,664,588 (GRCm39)	missense	possibly damaging	0.71
R9572:Astn2	UTSW	4	65,299,872 (GRCm39)	missense	unknown
R9573:Astn2	UTSW	4	65,566,591 (GRCm39)	missense	probably benign	0.08
R9674:Astn2	UTSW	4	65,460,963 (GRCm39)	missense	probably damaging	0.98
R9722:Astn2	UTSW	4	65,831,978 (GRCm39)	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- AGCCAGGGAATTGCCAAAGC -3'
(R):5'- GGTAAGCCTAGAGATGACAGCC -3'

Sequencing Primer
(F):5'- CTCACAGATAGGAGAAATGGGCTCTG -3'
(R):5'- CTGCTGCTCCCATGATAAGAGTG -3'

Posted On

2015-01-23