Incidental Mutation 'R2907:Atp7b'
ID261692
Institutional Source Beutler Lab
Gene Symbol Atp7b
Ensembl Gene ENSMUSG00000006567
Gene NameATPase, Cu++ transporting, beta polypeptide
SynonymsAtp7a, WND, Wilson protein
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.658) question?
Stock #R2907 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location21992785-22060305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22011554 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 781 (T781I)
Ref Sequence ENSEMBL: ENSMUSP00000106366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006742] [ENSMUST00000110738]
Predicted Effect probably damaging
Transcript: ENSMUST00000006742
AA Change: T896I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567
AA Change: T896I

DomainStartEndE-ValueType
Pfam:HMA 71 132 8.8e-14 PFAM
Pfam:HMA 156 217 6.6e-13 PFAM
Pfam:HMA 271 329 7.4e-13 PFAM
Pfam:HMA 364 425 1.1e-10 PFAM
Pfam:HMA 493 554 2.3e-14 PFAM
Pfam:HMA 569 630 3.1e-15 PFAM
transmembrane domain 656 675 N/A INTRINSIC
Pfam:E1-E2_ATPase 770 1018 3.3e-60 PFAM
Pfam:Hydrolase 1023 1276 1.3e-67 PFAM
Pfam:HAD 1026 1273 4.6e-10 PFAM
Pfam:Hydrolase_3 1243 1308 5.1e-7 PFAM
transmembrane domain 1322 1344 N/A INTRINSIC
low complexity region 1353 1370 N/A INTRINSIC
low complexity region 1418 1437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110738
AA Change: T781I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567
AA Change: T781I

DomainStartEndE-ValueType
Pfam:HMA 59 120 1.2e-13 PFAM
Pfam:HMA 144 205 9.7e-12 PFAM
PDB:2AW0|A 259 314 6e-6 PDB
Pfam:HMA 378 439 1.6e-13 PFAM
Pfam:HMA 454 515 1.5e-15 PFAM
transmembrane domain 541 560 N/A INTRINSIC
Pfam:E1-E2_ATPase 656 904 4.6e-50 PFAM
Pfam:Hydrolase 908 1161 6.6e-76 PFAM
Pfam:HAD 911 1158 1.5e-15 PFAM
Pfam:Hydrolase_3 1128 1193 8.5e-7 PFAM
transmembrane domain 1207 1229 N/A INTRINSIC
low complexity region 1238 1255 N/A INTRINSIC
low complexity region 1303 1322 N/A INTRINSIC
Meta Mutation Damage Score 0.456 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of the mouse gene results in copper accumulation in various organs, primarily the liver, kidney and brain, and a form of liver cirrhosis that resembles Wilson disease in humans and the 'toxic milk' phenotype in mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Atp7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Atp7b APN 8 22011098 missense possibly damaging 0.91
IGL00981:Atp7b APN 8 22027527 splice site probably null
IGL01600:Atp7b APN 8 22027525 splice site probably null
IGL01713:Atp7b APN 8 22028573 missense probably damaging 1.00
IGL01778:Atp7b APN 8 21994828 missense probably benign 0.42
IGL01926:Atp7b APN 8 22011781 missense probably damaging 0.98
IGL02312:Atp7b APN 8 21994770 missense probably damaging 0.99
IGL02562:Atp7b APN 8 22028085 missense probably benign
IGL02573:Atp7b APN 8 22022470 missense probably benign 0.00
IGL02603:Atp7b APN 8 21994776 missense possibly damaging 0.88
IGL02622:Atp7b APN 8 22028438 missense possibly damaging 0.69
IGL02721:Atp7b APN 8 22022477 missense probably benign 0.00
IGL03145:Atp7b APN 8 22018143 missense probably damaging 1.00
daffodil UTSW 8 21998266 missense probably damaging 1.00
PIT4131001:Atp7b UTSW 8 21994656 missense probably damaging 1.00
R0023:Atp7b UTSW 8 22011073 missense probably damaging 1.00
R0046:Atp7b UTSW 8 22059995 missense probably benign 0.00
R0128:Atp7b UTSW 8 22028172 missense possibly damaging 0.47
R0130:Atp7b UTSW 8 22028172 missense possibly damaging 0.47
R0325:Atp7b UTSW 8 22028451 missense probably benign 0.22
R0412:Atp7b UTSW 8 21995659 splice site probably null
R0856:Atp7b UTSW 8 21997631 missense probably damaging 1.00
R0906:Atp7b UTSW 8 22027826 missense probably benign
R0989:Atp7b UTSW 8 22028694 missense possibly damaging 0.51
R1377:Atp7b UTSW 8 22011785 missense probably benign 0.17
R1517:Atp7b UTSW 8 21997358 missense probably damaging 1.00
R1521:Atp7b UTSW 8 22027673 missense probably damaging 0.96
R1529:Atp7b UTSW 8 22028724 missense possibly damaging 0.87
R1691:Atp7b UTSW 8 22011023 missense possibly damaging 0.90
R1743:Atp7b UTSW 8 22006387 missense probably damaging 1.00
R1815:Atp7b UTSW 8 22011651 missense possibly damaging 0.80
R2008:Atp7b UTSW 8 22027980 missense probably damaging 1.00
R2133:Atp7b UTSW 8 22011077 missense probably damaging 1.00
R2155:Atp7b UTSW 8 22013584 missense possibly damaging 0.69
R2182:Atp7b UTSW 8 22014547 missense probably damaging 0.99
R2256:Atp7b UTSW 8 21998266 missense probably damaging 1.00
R2257:Atp7b UTSW 8 21998266 missense probably damaging 1.00
R2274:Atp7b UTSW 8 22020832 missense probably benign 0.20
R2475:Atp7b UTSW 8 21994776 missense possibly damaging 0.88
R2906:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R3421:Atp7b UTSW 8 22028670 missense probably damaging 1.00
R3422:Atp7b UTSW 8 22028670 missense probably damaging 1.00
R3688:Atp7b UTSW 8 22004230 missense probably damaging 1.00
R3945:Atp7b UTSW 8 22020864 missense probably benign 0.02
R4235:Atp7b UTSW 8 22011023 missense possibly damaging 0.90
R4700:Atp7b UTSW 8 22000121 missense probably benign 0.00
R4701:Atp7b UTSW 8 22000121 missense probably benign 0.00
R4877:Atp7b UTSW 8 22028601 missense probably damaging 0.98
R4962:Atp7b UTSW 8 22020885 missense probably damaging 1.00
R5009:Atp7b UTSW 8 22027698 missense possibly damaging 0.88
R5016:Atp7b UTSW 8 22015869 splice site probably null
R5038:Atp7b UTSW 8 22028456 missense possibly damaging 0.67
R5438:Atp7b UTSW 8 22014554 missense probably benign
R5467:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R5468:Atp7b UTSW 8 22059970 critical splice donor site probably null
R5512:Atp7b UTSW 8 22012739 missense probably benign 0.20
R5563:Atp7b UTSW 8 22028714 missense possibly damaging 0.82
R5751:Atp7b UTSW 8 22018128 missense probably damaging 1.00
R5773:Atp7b UTSW 8 22027863 missense probably benign
R5941:Atp7b UTSW 8 21997496 missense probably damaging 0.98
R6227:Atp7b UTSW 8 22020825 missense possibly damaging 0.63
R6265:Atp7b UTSW 8 22015927 nonsense probably null
R6290:Atp7b UTSW 8 22020820 missense probably damaging 1.00
R6368:Atp7b UTSW 8 22020755 splice site probably null
R6647:Atp7b UTSW 8 22028478 missense probably damaging 1.00
R6788:Atp7b UTSW 8 22004375 missense probably benign 0.37
R6830:Atp7b UTSW 8 22022365 missense probably damaging 0.97
R6886:Atp7b UTSW 8 22028690 missense probably benign 0.01
R6928:Atp7b UTSW 8 21994812 missense probably benign
R6965:Atp7b UTSW 8 22028085 missense probably benign
R7203:Atp7b UTSW 8 21997335 missense probably damaging 1.00
R7222:Atp7b UTSW 8 22022378 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATGAACCTTTGCAACCATTCC -3'
(R):5'- GGTCATGGTAGCCATTGGTC -3'

Sequencing Primer
(F):5'- TAATGCAGCCCAGGTAGTCTG -3'
(R):5'- CATGGTAGCCATTGGTCCATATG -3'
Posted On2015-01-23