Incidental Mutation 'R2907:Asxl3'
ID261715
Institutional Source Beutler Lab
Gene Symbol Asxl3
Ensembl Gene ENSMUSG00000045215
Gene Nameadditional sex combs like 3, transcriptional regulator
SynonymsD930044O18Rik, LOC381127, C230079D11Rik, D430002O22Rik
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock #R2907 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location22344883-22530227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22517273 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 773 (H773L)
Ref Sequence ENSEMBL: ENSMUSP00000112793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097655
AA Change: H773L

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: H773L

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 173 305 5.6e-50 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2139 2202 9.8e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120223
AA Change: H773L

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215
AA Change: H773L

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 179 304 1.3e-36 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2138 2202 1.9e-24 PFAM
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Asxl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Asxl3 APN 18 22525223 missense probably benign 0.41
IGL00510:Asxl3 APN 18 22523565 missense probably damaging 1.00
IGL00864:Asxl3 APN 18 22522446 missense probably benign 0.06
IGL01074:Asxl3 APN 18 22522845 missense probably damaging 1.00
IGL01305:Asxl3 APN 18 22516446 missense probably benign 0.06
IGL01313:Asxl3 APN 18 22517459 missense probably benign 0.41
IGL01349:Asxl3 APN 18 22524237 missense probably benign 0.28
IGL01529:Asxl3 APN 18 22517655 missense probably damaging 1.00
IGL01574:Asxl3 APN 18 22523564 missense probably benign 0.06
IGL01583:Asxl3 APN 18 22516597 missense probably benign 0.01
IGL01619:Asxl3 APN 18 22523328 missense probably damaging 1.00
IGL01720:Asxl3 APN 18 22525325 missense probably damaging 1.00
IGL01816:Asxl3 APN 18 22522488 missense probably benign 0.10
IGL01828:Asxl3 APN 18 22525558 utr 3 prime probably benign
IGL01903:Asxl3 APN 18 22434576 missense probably benign 0.00
IGL01906:Asxl3 APN 18 22522281 missense probably benign 0.01
IGL01962:Asxl3 APN 18 22522445 missense probably benign 0.00
IGL01991:Asxl3 APN 18 22516162 missense probably damaging 1.00
IGL02064:Asxl3 APN 18 22524344 missense possibly damaging 0.59
IGL02187:Asxl3 APN 18 22524978 missense probably damaging 0.99
IGL02219:Asxl3 APN 18 22453626 missense possibly damaging 0.81
IGL02309:Asxl3 APN 18 22522453 missense probably benign 0.01
IGL02478:Asxl3 APN 18 22523013 missense possibly damaging 0.77
IGL02506:Asxl3 APN 18 22452399 missense probably benign 0.19
IGL02660:Asxl3 APN 18 22524345 missense probably damaging 0.98
IGL02828:Asxl3 APN 18 22524661 missense possibly damaging 0.87
IGL02863:Asxl3 APN 18 22523484 missense probably benign 0.01
IGL03001:Asxl3 APN 18 22517398 missense probably damaging 1.00
IGL03143:Asxl3 APN 18 22522974 missense probably benign 0.43
ANU22:Asxl3 UTSW 18 22516446 missense probably benign 0.06
R0145:Asxl3 UTSW 18 22453605 missense probably damaging 1.00
R0201:Asxl3 UTSW 18 22523154 missense probably benign
R0207:Asxl3 UTSW 18 22411496 splice site probably benign
R0230:Asxl3 UTSW 18 22452326 splice site probably benign
R0242:Asxl3 UTSW 18 22516681 missense possibly damaging 0.94
R0242:Asxl3 UTSW 18 22516681 missense possibly damaging 0.94
R0344:Asxl3 UTSW 18 22517611 missense probably benign 0.00
R0519:Asxl3 UTSW 18 22523520 missense possibly damaging 0.85
R0520:Asxl3 UTSW 18 22522986 missense probably damaging 0.96
R0548:Asxl3 UTSW 18 22521792 splice site probably benign
R0626:Asxl3 UTSW 18 22522880 missense probably benign 0.02
R0711:Asxl3 UTSW 18 22524451 missense probably benign 0.01
R0744:Asxl3 UTSW 18 22516040 missense probably damaging 1.00
R0833:Asxl3 UTSW 18 22516040 missense probably damaging 1.00
R1035:Asxl3 UTSW 18 22525049 missense probably damaging 1.00
R1170:Asxl3 UTSW 18 22524507 missense probably benign 0.00
R1372:Asxl3 UTSW 18 22410009 missense probably benign 0.00
R1440:Asxl3 UTSW 18 22525224 missense probably benign 0.13
R1463:Asxl3 UTSW 18 22516753 missense possibly damaging 0.94
R1471:Asxl3 UTSW 18 22516354 missense probably damaging 1.00
R1618:Asxl3 UTSW 18 22516987 missense probably damaging 1.00
R1720:Asxl3 UTSW 18 22452435 missense probably damaging 1.00
R1819:Asxl3 UTSW 18 22522376 missense probably damaging 1.00
R1824:Asxl3 UTSW 18 22522068 missense probably damaging 1.00
R1851:Asxl3 UTSW 18 22517739 missense probably damaging 0.97
R1989:Asxl3 UTSW 18 22452363 missense probably damaging 1.00
R2041:Asxl3 UTSW 18 22523451 missense probably benign 0.02
R2174:Asxl3 UTSW 18 22453644 missense possibly damaging 0.76
R2175:Asxl3 UTSW 18 22516595 missense probably benign
R2443:Asxl3 UTSW 18 22411539 missense probably benign 0.12
R4246:Asxl3 UTSW 18 22525500 missense probably damaging 1.00
R4254:Asxl3 UTSW 18 22524366 missense possibly damaging 0.58
R4441:Asxl3 UTSW 18 22524233 missense probably damaging 0.97
R4660:Asxl3 UTSW 18 22516477 missense probably benign 0.00
R4661:Asxl3 UTSW 18 22516477 missense probably benign 0.00
R4674:Asxl3 UTSW 18 22517738 missense probably damaging 1.00
R4749:Asxl3 UTSW 18 22516769 missense probably damaging 0.99
R4817:Asxl3 UTSW 18 22525454 missense probably damaging 0.97
R4935:Asxl3 UTSW 18 22523312 missense probably benign 0.06
R5062:Asxl3 UTSW 18 22522718 missense possibly damaging 0.92
R5064:Asxl3 UTSW 18 22516019 missense probably benign 0.00
R5065:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5066:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5067:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5133:Asxl3 UTSW 18 22516708 missense probably damaging 1.00
R5174:Asxl3 UTSW 18 22523115 missense probably benign 0.45
R5183:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5294:Asxl3 UTSW 18 22516439 missense possibly damaging 0.77
R5416:Asxl3 UTSW 18 22524494 missense probably damaging 1.00
R5587:Asxl3 UTSW 18 22525247 missense probably benign 0.28
R5873:Asxl3 UTSW 18 22516085 missense probably benign 0.04
R6240:Asxl3 UTSW 18 22465508 missense probably damaging 1.00
R6242:Asxl3 UTSW 18 22522376 missense probably damaging 1.00
R6316:Asxl3 UTSW 18 22522782 missense probably damaging 1.00
R6348:Asxl3 UTSW 18 22517273 missense possibly damaging 0.56
R6518:Asxl3 UTSW 18 22516340 missense probably damaging 0.96
R6605:Asxl3 UTSW 18 22517077 nonsense probably null
R6704:Asxl3 UTSW 18 22517305 missense probably benign 0.00
R6706:Asxl3 UTSW 18 22453609 missense probably damaging 1.00
R6786:Asxl3 UTSW 18 22525440 missense probably damaging 1.00
R6799:Asxl3 UTSW 18 22465400 nonsense probably null
R6811:Asxl3 UTSW 18 22522911 missense possibly damaging 0.87
R6817:Asxl3 UTSW 18 22523580 missense probably benign 0.00
R6830:Asxl3 UTSW 18 22525388 missense probably benign 0.45
R6957:Asxl3 UTSW 18 22522091 missense probably damaging 1.00
R7015:Asxl3 UTSW 18 22523921 missense probably benign 0.00
R7058:Asxl3 UTSW 18 22517674 missense probably damaging 1.00
R7135:Asxl3 UTSW 18 22517701 nonsense probably null
R7135:Asxl3 UTSW 18 22517702 missense probably damaging 1.00
R7231:Asxl3 UTSW 18 22411499 critical splice acceptor site probably null
R7231:Asxl3 UTSW 18 22517540 missense probably damaging 1.00
Z1088:Asxl3 UTSW 18 22516772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCAATTCCTGCAGAGACTTC -3'
(R):5'- AGGGACTTCCAATGGTGCAG -3'

Sequencing Primer
(F):5'- CAGAGAAAGTCACCTTCAGGATCTG -3'
(R):5'- ATGGTGCAGACAACCCTTTC -3'
Posted On2015-01-23