Incidental Mutation 'R0335:Vmn2r8'
ID26182
Institutional Source Beutler Lab
Gene Symbol Vmn2r8
Ensembl Gene ENSMUSG00000090961
Gene Namevomeronasal 2, receptor 8
SynonymsEG627479
MMRRC Submission 038544-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R0335 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108797193-108808754 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to G at 108797451 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004943] [ENSMUST00000172140]
Predicted Effect probably null
Transcript: ENSMUST00000004943
SMART Domains Protein: ENSMUSP00000004943
Gene: ENSMUSG00000004821

DomainStartEndE-ValueType
EMP24_GP25L 17 210 1.11e-59 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172140
AA Change: L763F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126953
Gene: ENSMUSG00000090961
AA Change: L763F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 419 1.1e-28 PFAM
Pfam:NCD3G 507 561 8.2e-18 PFAM
Pfam:7tm_3 594 829 1.1e-54 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.6%
  • 20x: 87.5%
Validation Efficiency 100% (89/89)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik A G 14: 12,301,266 E124G possibly damaging Het
4932438A13Rik T C 3: 36,969,152 V2210A probably damaging Het
Adamts12 G T 15: 11,311,058 D1134Y possibly damaging Het
Add3 A G 19: 53,236,828 T460A probably benign Het
Amer3 A C 1: 34,579,300 probably benign Het
Arhgap22 C T 14: 33,359,108 probably benign Het
Arhgap32 T G 9: 32,259,760 S1279A probably benign Het
Bcas1 G A 2: 170,418,681 T26M probably damaging Het
Begain A T 12: 109,038,934 F256I probably damaging Het
Cabin1 A T 10: 75,657,049 I1804N probably damaging Het
Cad G A 5: 31,073,985 probably benign Het
Carmil1 G A 13: 24,073,983 S762L probably damaging Het
Ccdc93 T A 1: 121,492,977 L529Q probably damaging Het
Cdh12 T A 15: 21,578,549 probably null Het
Clip2 T A 5: 134,535,215 probably benign Het
Cmip T C 8: 117,445,366 I480T probably damaging Het
Cnot1 A T 8: 95,772,000 I203K probably benign Het
Col18a1 G A 10: 77,059,363 P1155S probably damaging Het
Col1a2 T A 6: 4,531,956 probably benign Het
Crybg3 A T 16: 59,544,140 L2373Q probably damaging Het
D130043K22Rik A T 13: 24,887,877 I935F probably damaging Het
Dapl1 T A 2: 59,496,594 D61E possibly damaging Het
Def6 A G 17: 28,228,069 D558G possibly damaging Het
Dnah6 T C 6: 73,069,399 probably benign Het
Dvl2 G A 11: 70,001,035 probably benign Het
Ecd A C 14: 20,320,734 V639G probably benign Het
Epg5 C T 18: 77,986,472 T1350M probably benign Het
Erbb4 C A 1: 68,259,259 M657I probably benign Het
Evi5 T C 5: 107,812,411 R431G probably benign Het
Fbxo11 G A 17: 88,015,613 A115V possibly damaging Het
Fgfr2 T C 7: 130,196,249 T192A probably benign Het
Gas7 C T 11: 67,662,052 A146V possibly damaging Het
Gatad2b T A 3: 90,356,182 S529T probably benign Het
Gm10722 G T 9: 3,001,048 Q41H probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm7535 A G 17: 17,911,112 probably benign Het
Gstm1 T A 3: 108,012,696 N193I possibly damaging Het
Heatr5b G A 17: 78,827,946 P252L probably benign Het
Hmgb1 A G 5: 149,050,631 V36A probably benign Het
Hrh1 G T 6: 114,480,232 W158L probably damaging Het
Ighv6-4 T C 12: 114,406,674 M53V probably benign Het
Iqgap2 T A 13: 95,635,633 D1346V probably damaging Het
Kcng3 A T 17: 83,587,737 N433K possibly damaging Het
Kif1a T A 1: 93,052,566 probably benign Het
Lctl C A 9: 64,118,887 Q75K probably benign Het
Ldb3 T A 14: 34,578,651 I89F possibly damaging Het
Lrrc49 A T 9: 60,677,095 L156Q probably damaging Het
Mark2 G T 19: 7,281,828 T83K probably benign Het
Ms4a15 A T 19: 10,980,210 D170E probably damaging Het
Msantd2 A G 9: 37,522,760 S99G possibly damaging Het
Nemf G T 12: 69,353,803 T124N probably benign Het
Nlrp9c A T 7: 26,394,136 F35I possibly damaging Het
Nwd2 A G 5: 63,804,773 I567V probably benign Het
Olfr111 A C 17: 37,530,642 I222L probably benign Het
Olfr1340 A G 4: 118,727,170 I308V probably null Het
Olfr323 T C 11: 58,625,740 Y102C probably damaging Het
Olfr828 T A 9: 18,815,994 Q100L probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pdk4 T C 6: 5,491,138 E209G probably benign Het
Plch1 T C 3: 63,710,978 Q712R probably damaging Het
Pnpla1 T A 17: 28,886,878 V569E possibly damaging Het
Prkar2a A T 9: 108,719,258 D134V probably damaging Het
Ptov1 T A 7: 44,864,622 Q40L possibly damaging Het
Ptprq T C 10: 107,708,728 I314V probably benign Het
Rabl2 T C 15: 89,583,966 K66E probably damaging Het
Rnf38 A G 4: 44,152,507 V19A possibly damaging Het
Scn2a T A 2: 65,682,091 W191R probably damaging Het
Sec22b T A 3: 97,921,256 F212I possibly damaging Het
Sec24c T A 14: 20,688,715 probably null Het
Sept2 T C 1: 93,495,599 S51P probably damaging Het
Serpinb1a T C 13: 32,848,656 N90S probably damaging Het
Slc1a2 C T 2: 102,743,863 T206I probably benign Het
Slc25a19 C A 11: 115,624,206 R42L probably damaging Het
St14 G A 9: 31,091,324 probably benign Het
Stxbp1 C T 2: 32,802,905 probably benign Het
Tas2r131 C T 6: 132,957,829 V6I probably benign Het
Tdo2 T A 3: 81,964,000 M235L probably benign Het
Tenm3 T G 8: 48,232,105 H2432P probably damaging Het
Tmprss15 C T 16: 79,024,742 probably benign Het
Tmx1 A G 12: 70,453,256 N30D probably benign Het
Tom1 A G 8: 75,064,392 probably null Het
Top2a T C 11: 99,022,955 N20S probably benign Het
Ttc23l T A 15: 10,539,963 T145S probably benign Het
Unc13b T A 4: 43,236,983 M3351K possibly damaging Het
Vmn1r47 T C 6: 90,022,659 S258P probably damaging Het
Vps11 T C 9: 44,353,838 Q641R probably null Het
Wapl T A 14: 34,692,324 I381N probably damaging Het
Zmym6 G A 4: 127,122,808 G794E probably damaging Het
Other mutations in Vmn2r8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02957:Vmn2r8 APN 5 108802225 missense probably benign 0.01
R0324:Vmn2r8 UTSW 5 108797941 unclassified probably null
R0394:Vmn2r8 UTSW 5 108802072 missense probably benign 0.12
R0501:Vmn2r8 UTSW 5 108803183 missense probably benign 0.03
R0615:Vmn2r8 UTSW 5 108799329 missense probably damaging 1.00
R0678:Vmn2r8 UTSW 5 108800546 missense probably benign 0.00
R1167:Vmn2r8 UTSW 5 108803176 missense probably benign 0.01
R1187:Vmn2r8 UTSW 5 108803219 nonsense probably null
R1406:Vmn2r8 UTSW 5 108802368 missense probably benign
R1406:Vmn2r8 UTSW 5 108802368 missense probably benign
R1451:Vmn2r8 UTSW 5 108798067 missense probably damaging 1.00
R1535:Vmn2r8 UTSW 5 108802174 missense probably damaging 1.00
R1795:Vmn2r8 UTSW 5 108803106 missense probably benign
R1874:Vmn2r8 UTSW 5 108802418 missense possibly damaging 0.74
R1908:Vmn2r8 UTSW 5 108797570 missense probably benign 0.03
R1925:Vmn2r8 UTSW 5 108802153 missense probably damaging 0.97
R1960:Vmn2r8 UTSW 5 108799286 missense probably damaging 0.99
R1961:Vmn2r8 UTSW 5 108798095 missense probably benign 0.45
R1967:Vmn2r8 UTSW 5 108802383 missense probably benign 0.01
R2095:Vmn2r8 UTSW 5 108808621 missense possibly damaging 0.94
R2159:Vmn2r8 UTSW 5 108802303 missense probably benign 0.22
R4240:Vmn2r8 UTSW 5 108797503 missense probably damaging 0.99
R4581:Vmn2r8 UTSW 5 108801704 missense probably benign 0.03
R4744:Vmn2r8 UTSW 5 108808581 missense probably benign 0.00
R4755:Vmn2r8 UTSW 5 108801700 missense probably benign 0.03
R4917:Vmn2r8 UTSW 5 108797398 missense probably damaging 1.00
R4957:Vmn2r8 UTSW 5 108799263 missense probably benign 0.16
R5141:Vmn2r8 UTSW 5 108808706 missense probably damaging 0.96
R5481:Vmn2r8 UTSW 5 108801770 missense probably benign 0.09
R5571:Vmn2r8 UTSW 5 108802240 missense probably damaging 1.00
R5624:Vmn2r8 UTSW 5 108802459 missense probably damaging 0.99
R6003:Vmn2r8 UTSW 5 108797382 missense probably damaging 1.00
R6243:Vmn2r8 UTSW 5 108799345 missense probably benign 0.01
R6265:Vmn2r8 UTSW 5 108808597 missense probably benign
R6315:Vmn2r8 UTSW 5 108801891 missense probably benign
R6413:Vmn2r8 UTSW 5 108801723 missense probably benign 0.09
R7120:Vmn2r8 UTSW 5 108808638 missense not run
Z1088:Vmn2r8 UTSW 5 108801998 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCCTGCACTAGAAGCCAAGATG -3'
(R):5'- TCAAGCTCACTACTCCAGGGAGAAG -3'

Sequencing Primer
(F):5'- AGCCAAGATGGAGAAAACCTC -3'
(R):5'- GGGCACCTAACTTGGTCATTC -3'
Posted On2013-04-16