Incidental Mutation 'R0392:Ift88'
ID261837
Institutional Source Beutler Lab
Gene Symbol Ift88
Ensembl Gene ENSMUSG00000040040
Gene Nameintraflagellar transport 88
SynonymsTg737Rpw, IFT88, Tg737, polaris, Oak Ridge polycystic kidneys, TgN737Rpw, orpk, fxo, Ttc10
MMRRC Submission 038598-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0392 (G1)
Quality Score24
Status Validated
Chromosome14
Chromosomal Location57424062-57517936 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 57496160 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122063]
Predicted Effect probably benign
Transcript: ENSMUST00000122063
SMART Domains Protein: ENSMUSP00000113768
Gene: ENSMUSG00000040040

DomainStartEndE-ValueType
Blast:TPR 197 229 8e-12 BLAST
TPR 233 266 5.35e-5 SMART
TPR 272 305 5.78e-1 SMART
TPR 485 518 5.73e-5 SMART
TPR 519 552 9.83e-4 SMART
TPR 553 586 5.19e-3 SMART
TPR 587 620 3.87e-2 SMART
Blast:TPR 621 654 7e-12 BLAST
TPR 655 688 3.76e0 SMART
low complexity region 730 748 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154492
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tetratrico peptide repeat (TPR) family. Mutations of a similar gene in mouse can cause polycystic kidney disease. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display early to mid-gestation lethality, random patterning of the left-right body axis, neural tube defects, pericardial sac expansion, enlarged limb buds, polydactyly, and absent embryonic node cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik T C 16: 4,977,499 noncoding transcript Het
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Bcan T A 3: 87,993,562 K455* probably null Het
Casp12 T A 9: 5,348,973 probably benign Het
Ccdc61 T C 7: 18,891,102 M504V probably benign Het
Cd53 A T 3: 106,763,276 V147E probably damaging Het
Cyp2b13 T C 7: 26,085,883 Y226H probably benign Het
Cyp2j7 T C 4: 96,199,434 D413G probably damaging Het
Dcbld1 T C 10: 52,317,134 I254T possibly damaging Het
Ddx39 T G 8: 83,721,737 M206R probably damaging Het
Dgki T A 6: 37,000,178 T666S probably damaging Het
Dnah7a C A 1: 53,504,198 C2271F probably damaging Het
Emilin3 A G 2: 160,910,879 probably benign Het
Epha4 T C 1: 77,506,973 K133R probably benign Het
Gm11146 T A 16: 77,597,166 probably benign Het
Ighv10-3 A G 12: 114,523,840 probably benign Het
Lamp5 T C 2: 136,060,897 S179P probably damaging Het
Map4 T C 9: 110,078,045 S788P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,762 I279N possibly damaging Het
Otog T C 7: 46,250,075 W267R probably benign Het
Pafah1b2 T C 9: 45,968,853 I175M probably benign Het
Pcdhb12 A G 18: 37,436,958 K386E possibly damaging Het
Pcnt T C 10: 76,384,826 N2056S probably benign Het
Pold2 T C 11: 5,876,776 I53V possibly damaging Het
Rsf1 T A 7: 97,679,005 D1071E probably benign Het
Rtp3 A T 9: 110,989,553 M20K probably damaging Het
S1pr5 T A 9: 21,244,981 I50F probably damaging Het
Slc47a1 A G 11: 61,371,782 S94P probably damaging Het
Slitrk5 G A 14: 111,679,033 V30I probably benign Het
St8sia5 G A 18: 77,254,406 V271M probably damaging Het
Sult2b1 G T 7: 45,733,638 T240N probably damaging Het
Other mutations in Ift88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Ift88 APN 14 57481386 unclassified probably benign
IGL00886:Ift88 APN 14 57478068 missense probably damaging 1.00
IGL00901:Ift88 APN 14 57444445 missense probably damaging 0.99
IGL01148:Ift88 APN 14 57439732 missense probably benign 0.19
IGL01346:Ift88 APN 14 57444405 missense probably damaging 1.00
IGL01474:Ift88 APN 14 57478074 missense probably benign 0.23
IGL02213:Ift88 APN 14 57478045 missense probably damaging 1.00
IGL02391:Ift88 APN 14 57481414 missense possibly damaging 0.64
IGL03087:Ift88 APN 14 57477957 missense probably benign 0.00
R0608:Ift88 UTSW 14 57496221 missense probably benign
R0718:Ift88 UTSW 14 57517413 missense probably benign 0.02
R1128:Ift88 UTSW 14 57517019 nonsense probably null
R1422:Ift88 UTSW 14 57438301 splice site probably benign
R1422:Ift88 UTSW 14 57472979 missense probably damaging 1.00
R1432:Ift88 UTSW 14 57437279 missense probably benign
R1518:Ift88 UTSW 14 57430628 missense possibly damaging 0.64
R1566:Ift88 UTSW 14 57441011 missense probably benign 0.36
R1819:Ift88 UTSW 14 57455519 missense probably damaging 1.00
R2239:Ift88 UTSW 14 57455504 missense probably damaging 1.00
R2273:Ift88 UTSW 14 57488936 missense possibly damaging 0.90
R2926:Ift88 UTSW 14 57488918 missense probably damaging 1.00
R3033:Ift88 UTSW 14 57478044 missense probably damaging 1.00
R3052:Ift88 UTSW 14 57430568 missense probably damaging 1.00
R3815:Ift88 UTSW 14 57440981 missense possibly damaging 0.88
R4411:Ift88 UTSW 14 57477979 missense probably damaging 0.99
R4703:Ift88 UTSW 14 57480850 unclassified probably benign
R4704:Ift88 UTSW 14 57480850 unclassified probably benign
R4822:Ift88 UTSW 14 57441869 splice site probably null
R5355:Ift88 UTSW 14 57438242 missense probably benign 0.34
R5618:Ift88 UTSW 14 57481508 missense possibly damaging 0.72
R6602:Ift88 UTSW 14 57507259 missense probably benign 0.00
R6907:Ift88 UTSW 14 57445610 missense probably benign 0.23
R7241:Ift88 UTSW 14 57479997 missense probably damaging 0.97
R7243:Ift88 UTSW 14 57430536 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGCACCTACAAGGAAGTCCATTCTC -3'
(R):5'- GCATTTCAGCTACAGCAGGCTGAC -3'

Sequencing Primer
(F):5'- tgaactcacagagatgtgcc -3'
(R):5'- CTACAGCAGGCTGACATTTTG -3'
Posted On2015-02-04