Incidental Mutation 'R0364:Vps39'
ID261851
Institutional Source Beutler Lab
Gene Symbol Vps39
Ensembl Gene ENSMUSG00000027291
Gene NameVPS39 HOPS complex subunit
SynonymsmVam6, Vam6P, Vam6, A230065P22Rik
MMRRC Submission 038570-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R0364 (G1)
Quality Score31
Status Validated
Chromosome2
Chromosomal Location120316461-120353137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 120345638 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 76 (K76T)
Ref Sequence ENSEMBL: ENSMUSP00000028752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028752] [ENSMUST00000102501]
Predicted Effect probably damaging
Transcript: ENSMUST00000028752
AA Change: K76T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028752
Gene: ENSMUSG00000027291
AA Change: K76T

DomainStartEndE-ValueType
Pfam:CNH 19 280 8.3e-53 PFAM
Pfam:Clathrin 410 536 3.9e-9 PFAM
Pfam:Vps39_1 449 551 1.7e-35 PFAM
Pfam:Clathrin 570 740 2.3e-8 PFAM
Pfam:Vps39_2 761 869 5.1e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102501
AA Change: K87T

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099559
Gene: ENSMUSG00000027291
AA Change: K87T

DomainStartEndE-ValueType
Pfam:CNH 20 291 1.3e-32 PFAM
Pfam:Clathrin 421 547 2e-9 PFAM
Pfam:Vps39_1 460 562 6.7e-36 PFAM
Pfam:Clathrin 582 751 2.3e-8 PFAM
Pfam:Vps39_2 772 880 6.6e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156296
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may promote clustering and fusion of late endosomes and lysosomes. The protein may also act as an adaptor protein that modulates the transforming growth factor-beta response by coupling the transforming growth factor-beta receptor complex to the Smad pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,611,128 probably benign Het
Ano7 A G 1: 93,388,658 D221G probably benign Het
Arhgef12 A T 9: 43,018,401 N199K probably damaging Het
Arpc2 A G 1: 74,236,887 N26S probably null Het
BC017158 C T 7: 128,290,614 R1H probably damaging Het
Camta2 G A 11: 70,683,310 T127I probably damaging Het
Ccdc13 T A 9: 121,798,216 N665I probably damaging Het
Ccdc178 C T 18: 21,915,062 R757H probably damaging Het
Cfap52 A C 11: 67,953,610 I93S possibly damaging Het
Cmklr1 A T 5: 113,614,517 L141H probably damaging Het
Crybb3 T A 5: 113,075,953 I197F probably damaging Het
Cryzl1 G A 16: 91,707,267 P97S probably benign Het
Cubn T C 2: 13,310,507 probably benign Het
Cyp2d37-ps T C 15: 82,690,052 noncoding transcript Het
Cyp4a12b C A 4: 115,432,920 N223K probably benign Het
Dennd2a T C 6: 39,508,299 T349A probably benign Het
Dnah12 A G 14: 26,724,473 T730A probably benign Het
Dock5 G A 14: 67,822,680 probably benign Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elmo1 A T 13: 20,564,493 K503* probably null Het
Endou A T 15: 97,718,973 probably benign Het
Eng T C 2: 32,679,137 S559P probably benign Het
Epc2 T A 2: 49,537,133 V563E possibly damaging Het
Fbxw17 T C 13: 50,432,441 S40P possibly damaging Het
Flt4 A T 11: 49,636,991 M924L probably benign Het
Fyb A G 15: 6,580,791 K282E probably damaging Het
Gabpa T A 16: 84,857,387 N317K possibly damaging Het
Gli3 G T 13: 15,724,764 G912V probably benign Het
Gm10295 C A 7: 71,350,613 C73F unknown Het
Gm10382 G T 5: 125,389,664 probably benign Het
Gp1ba T C 11: 70,640,458 probably benign Het
Gpr146 G A 5: 139,379,178 probably benign Het
Grm5 A G 7: 88,074,386 Y628C probably damaging Het
Hexa A G 9: 59,563,935 N491D probably benign Het
Hexdc T A 11: 121,212,143 H62Q probably benign Het
Hpx G T 7: 105,596,264 Q101K probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Inpp4b A T 8: 81,997,314 T492S probably benign Het
Iqgap2 A C 13: 95,731,275 probably benign Het
Islr2 T C 9: 58,199,744 T78A possibly damaging Het
Itga9 A G 9: 118,841,142 T177A probably benign Het
Itpkc A C 7: 27,227,749 S247A possibly damaging Het
Kirrel T C 3: 87,089,799 Y287C probably damaging Het
Kiz T G 2: 146,942,156 S536R probably benign Het
Klhl9 T G 4: 88,720,290 K571N probably benign Het
Kprp A T 3: 92,824,335 Y469* probably null Het
Ksr1 A T 11: 79,029,025 probably benign Het
Lrrc37a C T 11: 103,500,640 V1320I possibly damaging Het
Ltf A T 9: 111,025,167 N350I probably benign Het
Msl3l2 G A 10: 56,115,851 R224Q possibly damaging Het
Myh6 A T 14: 54,948,347 Y1490* probably null Het
Necap1 A G 6: 122,880,769 probably benign Het
Nf1 A T 11: 79,441,957 K810* probably null Het
Nkx6-3 A G 8: 23,157,706 E227G possibly damaging Het
Nlrp1a T A 11: 71,114,004 probably benign Het
Obscn G A 11: 59,128,281 A969V probably benign Het
Olfr1080 A T 2: 86,553,779 L115Q probably damaging Het
Olfr850 G A 9: 19,477,972 Q90* probably null Het
Olfr889 A G 9: 38,116,029 T78A probably benign Het
Olfr96 T C 17: 37,226,043 L306P possibly damaging Het
Pcdhb17 C A 18: 37,485,835 A226E possibly damaging Het
Phldb1 A T 9: 44,699,335 probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pon2 G A 6: 5,266,156 Q288* probably null Het
Prr14 G A 7: 127,474,579 R205H probably benign Het
Ptpn13 C A 5: 103,533,348 R805S probably damaging Het
Pyroxd2 A T 19: 42,747,553 V62D probably damaging Het
Rab37 G T 11: 115,156,964 C44F probably damaging Het
Rbm44 T C 1: 91,152,347 S52P probably benign Het
Scn5a T C 9: 119,522,599 D772G probably damaging Het
Slc7a5 A G 8: 121,885,015 F425L probably benign Het
Slk T A 19: 47,620,189 L527* probably null Het
Stpg4 T A 17: 87,389,714 probably null Het
Taar6 C A 10: 23,985,148 V167L probably benign Het
Tas2r123 T A 6: 132,847,681 S180R probably benign Het
Tmc2 C T 2: 130,202,103 R86W probably benign Het
Tmem200c T A 17: 68,840,548 V42E probably damaging Het
Trhde T C 10: 114,502,982 probably benign Het
Tshz1 A T 18: 84,016,124 I53N probably benign Het
Tshz3 A G 7: 36,770,533 E649G probably benign Het
Ttll7 C A 3: 146,945,181 R719S possibly damaging Het
Utp4 T C 8: 106,898,537 probably benign Het
Vmn1r35 A G 6: 66,678,843 I281T probably damaging Het
Wdr60 A G 12: 116,257,477 probably benign Het
Whamm A G 7: 81,594,051 T674A probably benign Het
Zbtb16 A G 9: 48,743,576 probably benign Het
Zfp623 T C 15: 75,948,661 S489P probably benign Het
Other mutations in Vps39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Vps39 APN 2 120350238 splice site probably benign
IGL01629:Vps39 APN 2 120323598 missense probably benign 0.11
IGL01812:Vps39 APN 2 120320790 splice site probably benign
IGL01936:Vps39 APN 2 120323128 missense probably benign 0.23
IGL02379:Vps39 APN 2 120323608 missense probably benign 0.17
IGL02892:Vps39 APN 2 120323171 splice site probably benign
IGL02943:Vps39 APN 2 120339487 missense possibly damaging 0.77
R0001:Vps39 UTSW 2 120318053 missense probably benign 0.09
R0329:Vps39 UTSW 2 120338787 missense possibly damaging 0.89
R0330:Vps39 UTSW 2 120338787 missense possibly damaging 0.89
R1483:Vps39 UTSW 2 120323648 missense probably damaging 1.00
R1625:Vps39 UTSW 2 120323625 missense probably damaging 1.00
R1837:Vps39 UTSW 2 120325397 missense probably damaging 1.00
R1839:Vps39 UTSW 2 120325397 missense probably damaging 1.00
R1934:Vps39 UTSW 2 120318077 missense probably damaging 1.00
R2018:Vps39 UTSW 2 120343227 missense probably damaging 1.00
R2019:Vps39 UTSW 2 120343227 missense probably damaging 1.00
R2178:Vps39 UTSW 2 120323679 nonsense probably null
R2513:Vps39 UTSW 2 120338787 missense probably damaging 1.00
R3771:Vps39 UTSW 2 120342016 missense possibly damaging 0.85
R3952:Vps39 UTSW 2 120350175 missense probably benign 0.15
R4580:Vps39 UTSW 2 120339333 missense probably benign 0.35
R4815:Vps39 UTSW 2 120338559 missense probably benign 0.37
R4851:Vps39 UTSW 2 120321831 intron probably benign
R4894:Vps39 UTSW 2 120352959 missense probably damaging 1.00
R5447:Vps39 UTSW 2 120352932 missense probably benign 0.43
R5483:Vps39 UTSW 2 120323083 missense probably benign 0.08
R5715:Vps39 UTSW 2 120325236 missense possibly damaging 0.73
R5886:Vps39 UTSW 2 120321572 intron probably benign
R5949:Vps39 UTSW 2 120328668 missense probably benign 0.23
R5954:Vps39 UTSW 2 120324662 missense probably damaging 1.00
R5973:Vps39 UTSW 2 120328705 missense probably damaging 0.99
R6004:Vps39 UTSW 2 120345650 missense possibly damaging 0.89
R6208:Vps39 UTSW 2 120333416 missense probably damaging 0.98
R6705:Vps39 UTSW 2 120320676 missense probably benign 0.00
R6915:Vps39 UTSW 2 120321031 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCCTGTGAAGTGTGTCAGCCTCC -3'
(R):5'- TGCCCGAATCTTCTGTCACAAGC -3'

Sequencing Primer
(F):5'- TCGGCATGATGATCACTAAACAG -3'
(R):5'- GAATCTTCTGTCACAAGCAGAAAC -3'
Posted On2015-02-04