Incidental Mutation 'R0335:Nlrp9c'
ID26191
Institutional Source Beutler Lab
Gene Symbol Nlrp9c
Ensembl Gene ENSMUSG00000040614
Gene NameNLR family, pyrin domain containing 9C
SynonymsNalp9c, Nalp-zeta
MMRRC Submission 038544-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0335 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26322473-26403700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26394136 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 35 (F35I)
Ref Sequence ENSEMBL: ENSMUSP00000083106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041845] [ENSMUST00000085944]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041845
AA Change: F35I

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036041
Gene: ENSMUSG00000040614
AA Change: F35I

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 5.2e-31 PFAM
LRR 637 664 4.36e1 SMART
Blast:LRR 666 691 3e-6 BLAST
LRR 693 720 1.02e0 SMART
LRR 722 749 3e0 SMART
LRR 750 777 6.88e-4 SMART
LRR 779 806 5.06e0 SMART
LRR 807 834 1.22e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000085944
AA Change: F35I

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083106
Gene: ENSMUSG00000040614
AA Change: F35I

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 2.8e-31 PFAM
LRR 631 658 7.49e0 SMART
LRR 692 719 4.36e1 SMART
Blast:LRR 721 746 8e-6 BLAST
LRR 748 775 1.02e0 SMART
LRR 777 804 3e0 SMART
LRR 805 832 6.88e-4 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.12e-4 SMART
LRR 919 946 1.22e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160948
Meta Mutation Damage Score 0.014 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.6%
  • 20x: 87.5%
Validation Efficiency 100% (89/89)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik A G 14: 12,301,266 E124G possibly damaging Het
4932438A13Rik T C 3: 36,969,152 V2210A probably damaging Het
Adamts12 G T 15: 11,311,058 D1134Y possibly damaging Het
Add3 A G 19: 53,236,828 T460A probably benign Het
Amer3 A C 1: 34,579,300 probably benign Het
Arhgap22 C T 14: 33,359,108 probably benign Het
Arhgap32 T G 9: 32,259,760 S1279A probably benign Het
Bcas1 G A 2: 170,418,681 T26M probably damaging Het
Begain A T 12: 109,038,934 F256I probably damaging Het
Cabin1 A T 10: 75,657,049 I1804N probably damaging Het
Cad G A 5: 31,073,985 probably benign Het
Carmil1 G A 13: 24,073,983 S762L probably damaging Het
Ccdc93 T A 1: 121,492,977 L529Q probably damaging Het
Cdh12 T A 15: 21,578,549 probably null Het
Clip2 T A 5: 134,535,215 probably benign Het
Cmip T C 8: 117,445,366 I480T probably damaging Het
Cnot1 A T 8: 95,772,000 I203K probably benign Het
Col18a1 G A 10: 77,059,363 P1155S probably damaging Het
Col1a2 T A 6: 4,531,956 probably benign Het
Crybg3 A T 16: 59,544,140 L2373Q probably damaging Het
D130043K22Rik A T 13: 24,887,877 I935F probably damaging Het
Dapl1 T A 2: 59,496,594 D61E possibly damaging Het
Def6 A G 17: 28,228,069 D558G possibly damaging Het
Dnah6 T C 6: 73,069,399 probably benign Het
Dvl2 G A 11: 70,001,035 probably benign Het
Ecd A C 14: 20,320,734 V639G probably benign Het
Epg5 C T 18: 77,986,472 T1350M probably benign Het
Erbb4 C A 1: 68,259,259 M657I probably benign Het
Evi5 T C 5: 107,812,411 R431G probably benign Het
Fbxo11 G A 17: 88,015,613 A115V possibly damaging Het
Fgfr2 T C 7: 130,196,249 T192A probably benign Het
Gas7 C T 11: 67,662,052 A146V possibly damaging Het
Gatad2b T A 3: 90,356,182 S529T probably benign Het
Gm10722 G T 9: 3,001,048 Q41H probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm7535 A G 17: 17,911,112 probably benign Het
Gstm1 T A 3: 108,012,696 N193I possibly damaging Het
Heatr5b G A 17: 78,827,946 P252L probably benign Het
Hmgb1 A G 5: 149,050,631 V36A probably benign Het
Hrh1 G T 6: 114,480,232 W158L probably damaging Het
Ighv6-4 T C 12: 114,406,674 M53V probably benign Het
Iqgap2 T A 13: 95,635,633 D1346V probably damaging Het
Kcng3 A T 17: 83,587,737 N433K possibly damaging Het
Kif1a T A 1: 93,052,566 probably benign Het
Lctl C A 9: 64,118,887 Q75K probably benign Het
Ldb3 T A 14: 34,578,651 I89F possibly damaging Het
Lrrc49 A T 9: 60,677,095 L156Q probably damaging Het
Mark2 G T 19: 7,281,828 T83K probably benign Het
Ms4a15 A T 19: 10,980,210 D170E probably damaging Het
Msantd2 A G 9: 37,522,760 S99G possibly damaging Het
Nemf G T 12: 69,353,803 T124N probably benign Het
Nwd2 A G 5: 63,804,773 I567V probably benign Het
Olfr111 A C 17: 37,530,642 I222L probably benign Het
Olfr1340 A G 4: 118,727,170 I308V probably null Het
Olfr323 T C 11: 58,625,740 Y102C probably damaging Het
Olfr828 T A 9: 18,815,994 Q100L probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pdk4 T C 6: 5,491,138 E209G probably benign Het
Plch1 T C 3: 63,710,978 Q712R probably damaging Het
Pnpla1 T A 17: 28,886,878 V569E possibly damaging Het
Prkar2a A T 9: 108,719,258 D134V probably damaging Het
Ptov1 T A 7: 44,864,622 Q40L possibly damaging Het
Ptprq T C 10: 107,708,728 I314V probably benign Het
Rabl2 T C 15: 89,583,966 K66E probably damaging Het
Rnf38 A G 4: 44,152,507 V19A possibly damaging Het
Scn2a T A 2: 65,682,091 W191R probably damaging Het
Sec22b T A 3: 97,921,256 F212I possibly damaging Het
Sec24c T A 14: 20,688,715 probably null Het
Sept2 T C 1: 93,495,599 S51P probably damaging Het
Serpinb1a T C 13: 32,848,656 N90S probably damaging Het
Slc1a2 C T 2: 102,743,863 T206I probably benign Het
Slc25a19 C A 11: 115,624,206 R42L probably damaging Het
St14 G A 9: 31,091,324 probably benign Het
Stxbp1 C T 2: 32,802,905 probably benign Het
Tas2r131 C T 6: 132,957,829 V6I probably benign Het
Tdo2 T A 3: 81,964,000 M235L probably benign Het
Tenm3 T G 8: 48,232,105 H2432P probably damaging Het
Tmprss15 C T 16: 79,024,742 probably benign Het
Tmx1 A G 12: 70,453,256 N30D probably benign Het
Tom1 A G 8: 75,064,392 probably null Het
Top2a T C 11: 99,022,955 N20S probably benign Het
Ttc23l T A 15: 10,539,963 T145S probably benign Het
Unc13b T A 4: 43,236,983 M3351K possibly damaging Het
Vmn1r47 T C 6: 90,022,659 S258P probably damaging Het
Vmn2r8 T G 5: 108,797,451 probably null Het
Vps11 T C 9: 44,353,838 Q641R probably null Het
Wapl T A 14: 34,692,324 I381N probably damaging Het
Zmym6 G A 4: 127,122,808 G794E probably damaging Het
Other mutations in Nlrp9c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Nlrp9c APN 7 26384588 missense probably benign 0.00
IGL00814:Nlrp9c APN 7 26384750 missense probably benign 0.23
IGL00919:Nlrp9c APN 7 26394056 nonsense probably null
IGL01762:Nlrp9c APN 7 26385425 missense probably damaging 1.00
IGL01928:Nlrp9c APN 7 26375422 splice site probably benign
IGL02008:Nlrp9c APN 7 26385151 missense probably benign 0.16
IGL02389:Nlrp9c APN 7 26394207 missense probably benign
IGL02535:Nlrp9c APN 7 26372097 missense probably damaging 1.00
IGL02685:Nlrp9c APN 7 26385557 missense probably damaging 0.98
IGL02904:Nlrp9c APN 7 26375290 missense probably damaging 1.00
IGL02935:Nlrp9c APN 7 26385276 missense probably benign 0.00
IGL03006:Nlrp9c APN 7 26372082 missense probably damaging 0.98
IGL03140:Nlrp9c APN 7 26380489 missense probably benign 0.30
IGL03201:Nlrp9c APN 7 26385108 missense probably benign 0.00
IGL03243:Nlrp9c APN 7 26365032 missense probably damaging 0.99
IGL03054:Nlrp9c UTSW 7 26382276 splice site probably null
K7894:Nlrp9c UTSW 7 26384898 missense possibly damaging 0.94
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0391:Nlrp9c UTSW 7 26371476 splice site probably benign
R0433:Nlrp9c UTSW 7 26385819 missense probably benign 0.20
R1035:Nlrp9c UTSW 7 26371277 splice site probably benign
R1118:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1119:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1173:Nlrp9c UTSW 7 26380435 missense probably damaging 1.00
R1519:Nlrp9c UTSW 7 26378101 missense possibly damaging 0.88
R1528:Nlrp9c UTSW 7 26382298 missense probably damaging 0.99
R1616:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1774:Nlrp9c UTSW 7 26394118 missense probably benign 0.05
R1789:Nlrp9c UTSW 7 26380490 missense probably benign 0.00
R1869:Nlrp9c UTSW 7 26384820 nonsense probably null
R1870:Nlrp9c UTSW 7 26384820 nonsense probably null
R1920:Nlrp9c UTSW 7 26384894 missense probably damaging 1.00
R1987:Nlrp9c UTSW 7 26378056 missense probably benign 0.31
R2022:Nlrp9c UTSW 7 26384796 missense probably damaging 1.00
R2309:Nlrp9c UTSW 7 26378087 missense probably damaging 1.00
R2327:Nlrp9c UTSW 7 26375322 missense probably damaging 1.00
R3405:Nlrp9c UTSW 7 26385282 missense probably benign 0.01
R3548:Nlrp9c UTSW 7 26371451 missense probably damaging 1.00
R3846:Nlrp9c UTSW 7 26382276 splice site probably null
R4179:Nlrp9c UTSW 7 26384661 missense possibly damaging 0.74
R4460:Nlrp9c UTSW 7 26378098 missense probably damaging 1.00
R4669:Nlrp9c UTSW 7 26375368 missense possibly damaging 0.90
R4708:Nlrp9c UTSW 7 26384840 missense probably benign 0.07
R4810:Nlrp9c UTSW 7 26378177 splice site probably null
R4824:Nlrp9c UTSW 7 26380564 missense possibly damaging 0.49
R4915:Nlrp9c UTSW 7 26384460 missense probably benign 0.34
R4996:Nlrp9c UTSW 7 26385747 missense possibly damaging 0.92
R5468:Nlrp9c UTSW 7 26365000 missense probably benign 0.00
R5525:Nlrp9c UTSW 7 26384501 missense probably damaging 1.00
R5526:Nlrp9c UTSW 7 26382366 missense possibly damaging 0.95
R6020:Nlrp9c UTSW 7 26384725 missense probably benign 0.08
R6175:Nlrp9c UTSW 7 26378001 splice site probably null
R6454:Nlrp9c UTSW 7 26385774 missense possibly damaging 0.91
R6493:Nlrp9c UTSW 7 26382387 missense probably damaging 1.00
R6649:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6653:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6739:Nlrp9c UTSW 7 26385425 missense probably damaging 0.99
R6883:Nlrp9c UTSW 7 26378131 missense probably benign 0.18
R7097:Nlrp9c UTSW 7 26385621 missense probably damaging 1.00
R7122:Nlrp9c UTSW 7 26385621 missense probably damaging 1.00
R7174:Nlrp9c UTSW 7 26385297 missense probably benign 0.03
R7365:Nlrp9c UTSW 7 26371397 missense possibly damaging 0.93
R7378:Nlrp9c UTSW 7 26365015 missense probably benign 0.14
R7427:Nlrp9c UTSW 7 26371435 missense probably benign 0.00
R7450:Nlrp9c UTSW 7 26364939 missense probably benign 0.45
X0065:Nlrp9c UTSW 7 26380430 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCTGACCCCATTTAAAAGATGGTCTG -3'
(R):5'- AGACTGAACGCTGATGTCTTTCTTCC -3'

Sequencing Primer
(F):5'- agtggggaaggaagggag -3'
(R):5'- ATCTAGCTATGGCTTGCTGC -3'
Posted On2013-04-16