Incidental Mutation 'R0015:Ntrk1'
List |< first << previous [record 49 of 76] next >> last >|
ID262079
Institutional Source Beutler Lab
Gene Symbol Ntrk1
Ensembl Gene ENSMUSG00000028072
Gene Nameneurotrophic tyrosine kinase, receptor, type 1
SynonymsTkr, TrkA
MMRRC Submission 038310-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0015 (G1)
Quality Score58
Status Validated
Chromosome3
Chromosomal Location87778244-87795162 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 87791750 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000088503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029712] [ENSMUST00000029714] [ENSMUST00000090981]
Predicted Effect probably benign
Transcript: ENSMUST00000029712
SMART Domains Protein: ENSMUSP00000029712
Gene: ENSMUSG00000028072

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:LRR_8 91 150 8.9e-14 PFAM
Pfam:TPKR_C2 151 194 4.9e-15 PFAM
IG 202 285 3.2e-2 SMART
low complexity region 419 442 N/A INTRINSIC
TyrKc 513 784 2.31e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine kinase receptor (NTKR) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. The presence of this kinase leads to cell differentiation and may play a role in specifying sensory neuron subtypes. Mutations in this gene have been associated with congenital insensitivity to pain, anhidrosis, self-mutilating behavior, mental retardation and cancer. Alternate transcriptional splice variants of this gene have been found, but only three have been characterized to date. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutations result in premature death due to severe sensory and sympathetic neuropathies. A conditional mutant mouse exhibits defects in mast cell and B cell physiology. Homozygotes for a point mutation are normal, but are subject to pharmacological control of signalling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,186,184 R408H probably damaging Het
A130050O07Rik A G 1: 137,928,656 Y23C unknown Het
Adcy3 G A 12: 4,195,260 probably null Het
Aldh6a1 G A 12: 84,441,780 L86F probably damaging Het
Arl10 G T 13: 54,575,957 probably benign Het
Armc3 A G 2: 19,296,321 probably null Het
Astn2 T G 4: 66,266,382 probably null Het
Cacna1d G A 14: 30,114,971 T804I probably benign Het
Ccny A C 18: 9,316,682 probably benign Het
Cdh5 C T 8: 104,140,927 T612I probably benign Het
Cfap58 A G 19: 48,029,100 M800V probably benign Het
Clrn1 A T 3: 58,846,427 I171K probably damaging Het
Cnp T A 11: 100,578,908 probably null Het
Col12a1 T C 9: 79,651,385 T1933A probably damaging Het
Cwf19l2 A G 9: 3,454,666 S660G probably benign Het
Dync1i2 C A 2: 71,214,484 R13S probably damaging Het
Eps8l1 A T 7: 4,477,557 probably benign Het
Espn T C 4: 152,139,152 T188A possibly damaging Het
F2 T C 2: 91,630,607 E260G probably benign Het
Fat4 T A 3: 38,982,503 S3435T probably damaging Het
Fchsd1 A G 18: 37,962,959 C533R probably benign Het
Fstl5 G A 3: 76,322,191 V100M probably damaging Het
Gls2 T G 10: 128,209,350 L572R probably damaging Het
Gm20939 A T 17: 94,876,768 E281D probably benign Het
Gpr35 T G 1: 92,983,232 L222W probably damaging Het
Hsf5 C A 11: 87,657,335 H615N probably benign Het
Id2 C T 12: 25,095,803 D70N probably damaging Het
Ints2 T C 11: 86,249,287 T240A probably damaging Het
Kcnn3 A C 3: 89,662,773 D631A probably damaging Het
Klhdc8a A G 1: 132,303,005 T203A probably damaging Het
Lama4 C T 10: 39,075,436 T1059M possibly damaging Het
Lgals8 A G 13: 12,447,298 L226P probably damaging Het
Lifr T A 15: 7,188,186 probably null Het
Lonp1 T A 17: 56,618,406 Q462L probably benign Het
Lypd1 A G 1: 125,910,438 V48A possibly damaging Het
Mapkapk2 A G 1: 131,097,326 I67T possibly damaging Het
Mbd3l1 A T 9: 18,484,858 D93V probably benign Het
Mdh1b T C 1: 63,721,800 probably benign Het
Myh7b C T 2: 155,622,286 P569L probably damaging Het
Ncapd3 C A 9: 27,051,809 A470E probably damaging Het
Ndrg2 A G 14: 51,910,445 probably benign Het
Nprl2 A T 9: 107,544,419 I209F probably damaging Het
Olfm2 T C 9: 20,668,741 E268G probably damaging Het
Olfr884 T A 9: 38,047,667 Y148* probably null Het
Pcf11 T A 7: 92,658,317 H881L probably benign Het
Pde10a A G 17: 8,977,197 D640G probably damaging Het
Pde9a G A 17: 31,386,356 probably null Het
Pianp G T 6: 125,001,540 G236V probably damaging Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Ppp1r3a A G 6: 14,717,661 S1085P possibly damaging Het
Pter G A 2: 13,001,000 G328D probably damaging Het
Rad51 T A 2: 119,116,327 M5K probably benign Het
Rbm43 T A 2: 51,925,667 I181F probably benign Het
Rgs12 T C 5: 35,022,776 probably benign Het
Rnf213 A C 11: 119,441,606 D2547A possibly damaging Het
Slc20a2 C A 8: 22,535,345 A21E probably damaging Het
Stab2 A G 10: 86,843,617 S2503P probably benign Het
Sv2b A T 7: 75,125,641 F479L probably damaging Het
Sybu T C 15: 44,673,500 R349G probably damaging Het
Tead3 T C 17: 28,341,351 Y2C probably damaging Het
Tnrc6c T A 11: 117,721,458 N307K probably damaging Het
Ubxn11 C G 4: 134,116,025 probably null Het
Ust T C 10: 8,330,065 probably benign Het
Vmn2r116 T A 17: 23,401,849 N852K probably benign Het
Zgrf1 T C 3: 127,555,397 probably benign Het
Other mutations in Ntrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ntrk1 APN 3 87791438 missense possibly damaging 0.94
IGL00756:Ntrk1 APN 3 87783697 missense probably benign 0.05
IGL01340:Ntrk1 APN 3 87788714 missense possibly damaging 0.72
IGL02262:Ntrk1 APN 3 87781797 missense probably damaging 1.00
IGL02268:Ntrk1 APN 3 87781531 missense probably damaging 1.00
IGL02290:Ntrk1 APN 3 87781771 missense probably benign 0.11
IGL02435:Ntrk1 APN 3 87788732 missense probably benign 0.01
IGL03007:Ntrk1 APN 3 87782743 missense possibly damaging 0.56
PIT4802001:Ntrk1 UTSW 3 87788634 missense probably damaging 0.98
R0140:Ntrk1 UTSW 3 87778568 missense probably damaging 1.00
R0269:Ntrk1 UTSW 3 87783933 missense possibly damaging 0.78
R0457:Ntrk1 UTSW 3 87791707 missense probably benign
R0617:Ntrk1 UTSW 3 87783933 missense possibly damaging 0.78
R1144:Ntrk1 UTSW 3 87781542 missense probably damaging 1.00
R1152:Ntrk1 UTSW 3 87778593 missense probably benign 0.33
R1439:Ntrk1 UTSW 3 87789611 splice site probably null
R1588:Ntrk1 UTSW 3 87780077 nonsense probably null
R1764:Ntrk1 UTSW 3 87780084 missense probably damaging 0.99
R1766:Ntrk1 UTSW 3 87778518 missense probably damaging 1.00
R1771:Ntrk1 UTSW 3 87789630 missense probably benign
R2264:Ntrk1 UTSW 3 87779634 critical splice donor site probably null
R2377:Ntrk1 UTSW 3 87791407 missense possibly damaging 0.70
R4059:Ntrk1 UTSW 3 87781479 missense probably damaging 1.00
R4950:Ntrk1 UTSW 3 87789611 splice site probably null
R5107:Ntrk1 UTSW 3 87794973 missense probably benign 0.01
R5805:Ntrk1 UTSW 3 87780172 missense probably damaging 1.00
R6073:Ntrk1 UTSW 3 87791370 splice site probably null
R6372:Ntrk1 UTSW 3 87786048 missense probably benign
R6894:Ntrk1 UTSW 3 87782802 missense probably damaging 1.00
R6972:Ntrk1 UTSW 3 87783981 missense probably damaging 1.00
R6973:Ntrk1 UTSW 3 87783981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCACCCCTCTCCATAAGTTAC -3'
(R):5'- TGAGGACACCCCTGTGTGTTTCTG -3'

Sequencing Primer
(F):5'- CATAAGTTACCTGGACCCCTC -3'
(R):5'- AGTCATGTCAGCATGTGGG -3'
Posted On2015-02-04