Incidental Mutation 'R0335:Dvl2'
ID26209
Institutional Source Beutler Lab
Gene Symbol Dvl2
Ensembl Gene ENSMUSG00000020888
Gene Namedishevelled segment polarity protein 2
Synonyms
MMRRC Submission 038544-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R0335 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70000595-70012301 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 70001035 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018716] [ENSMUST00000019362] [ENSMUST00000101526] [ENSMUST00000102575] [ENSMUST00000133485] [ENSMUST00000135814] [ENSMUST00000138186] [ENSMUST00000153684] [ENSMUST00000190940]
Predicted Effect probably benign
Transcript: ENSMUST00000018716
SMART Domains Protein: ENSMUSP00000018716
Gene: ENSMUSG00000018572

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
low complexity region 188 196 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
low complexity region 225 241 N/A INTRINSIC
low complexity region 247 261 N/A INTRINSIC
low complexity region 263 286 N/A INTRINSIC
PHD 339 383 1.2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019362
SMART Domains Protein: ENSMUSP00000019362
Gene: ENSMUSG00000020888

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
Pfam:Dishevelled 103 263 1.5e-60 PFAM
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101526
SMART Domains Protein: ENSMUSP00000099064
Gene: ENSMUSG00000018572

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 121 129 N/A INTRINSIC
low complexity region 143 157 N/A INTRINSIC
low complexity region 158 174 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 196 219 N/A INTRINSIC
PHD 272 316 1.2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102575
SMART Domains Protein: ENSMUSP00000099635
Gene: ENSMUSG00000020888

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
low complexity region 112 122 N/A INTRINSIC
Pfam:Dishevelled 160 232 8.1e-27 PFAM
low complexity region 250 262 N/A INTRINSIC
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.3e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130820
Predicted Effect probably benign
Transcript: ENSMUST00000133485
SMART Domains Protein: ENSMUSP00000117373
Gene: ENSMUSG00000018572

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 58 66 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 117 131 N/A INTRINSIC
low complexity region 133 156 N/A INTRINSIC
PHD 209 253 1.2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135422
Predicted Effect probably benign
Transcript: ENSMUST00000135814
SMART Domains Protein: ENSMUSP00000120665
Gene: ENSMUSG00000018572

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 58 66 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 117 131 N/A INTRINSIC
low complexity region 133 156 N/A INTRINSIC
PHD 209 253 1.2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138186
SMART Domains Protein: ENSMUSP00000117635
Gene: ENSMUSG00000018572

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 137 151 N/A INTRINSIC
low complexity region 178 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149477
Predicted Effect probably benign
Transcript: ENSMUST00000153684
SMART Domains Protein: ENSMUSP00000121780
Gene: ENSMUSG00000018572

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 58 66 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 117 131 N/A INTRINSIC
low complexity region 133 156 N/A INTRINSIC
PHD 209 253 1.2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190940
SMART Domains Protein: ENSMUSP00000140073
Gene: ENSMUSG00000020888

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
low complexity region 112 122 N/A INTRINSIC
Pfam:Dishevelled 160 232 8.1e-27 PFAM
low complexity region 250 262 N/A INTRINSIC
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.3e-79 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.6%
  • 20x: 87.5%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dishevelled (dsh) protein family. The vertebrate dsh proteins have approximately 40% amino acid sequence similarity with Drosophila dsh. This gene encodes a 90-kD protein that undergoes posttranslational phosphorylation to form a 95-kD cytoplasmic protein, which may play a role in the signal transduction pathway mediated by multiple Wnt proteins. The mechanisms of dishevelled function in Wnt signaling are likely to be conserved among metazoans. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice show incomplete penetrance of perinatal lethality with surviving mice being predominantly female. Defects include cardiovascular outflow and neural tube abnormalities, malformations of vertebrae and ribs, and irregular somite segmentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik A G 14: 12,301,266 E124G possibly damaging Het
4932438A13Rik T C 3: 36,969,152 V2210A probably damaging Het
Adamts12 G T 15: 11,311,058 D1134Y possibly damaging Het
Add3 A G 19: 53,236,828 T460A probably benign Het
Amer3 A C 1: 34,579,300 probably benign Het
Arhgap22 C T 14: 33,359,108 probably benign Het
Arhgap32 T G 9: 32,259,760 S1279A probably benign Het
Bcas1 G A 2: 170,418,681 T26M probably damaging Het
Begain A T 12: 109,038,934 F256I probably damaging Het
Cabin1 A T 10: 75,657,049 I1804N probably damaging Het
Cad G A 5: 31,073,985 probably benign Het
Carmil1 G A 13: 24,073,983 S762L probably damaging Het
Ccdc93 T A 1: 121,492,977 L529Q probably damaging Het
Cdh12 T A 15: 21,578,549 probably null Het
Clip2 T A 5: 134,535,215 probably benign Het
Cmip T C 8: 117,445,366 I480T probably damaging Het
Cnot1 A T 8: 95,772,000 I203K probably benign Het
Col18a1 G A 10: 77,059,363 P1155S probably damaging Het
Col1a2 T A 6: 4,531,956 probably benign Het
Crybg3 A T 16: 59,544,140 L2373Q probably damaging Het
D130043K22Rik A T 13: 24,887,877 I935F probably damaging Het
Dapl1 T A 2: 59,496,594 D61E possibly damaging Het
Def6 A G 17: 28,228,069 D558G possibly damaging Het
Dnah6 T C 6: 73,069,399 probably benign Het
Ecd A C 14: 20,320,734 V639G probably benign Het
Epg5 C T 18: 77,986,472 T1350M probably benign Het
Erbb4 C A 1: 68,259,259 M657I probably benign Het
Evi5 T C 5: 107,812,411 R431G probably benign Het
Fbxo11 G A 17: 88,015,613 A115V possibly damaging Het
Fgfr2 T C 7: 130,196,249 T192A probably benign Het
Gas7 C T 11: 67,662,052 A146V possibly damaging Het
Gatad2b T A 3: 90,356,182 S529T probably benign Het
Gm10722 G T 9: 3,001,048 Q41H probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm7535 A G 17: 17,911,112 probably benign Het
Gstm1 T A 3: 108,012,696 N193I possibly damaging Het
Heatr5b G A 17: 78,827,946 P252L probably benign Het
Hmgb1 A G 5: 149,050,631 V36A probably benign Het
Hrh1 G T 6: 114,480,232 W158L probably damaging Het
Ighv6-4 T C 12: 114,406,674 M53V probably benign Het
Iqgap2 T A 13: 95,635,633 D1346V probably damaging Het
Kcng3 A T 17: 83,587,737 N433K possibly damaging Het
Kif1a T A 1: 93,052,566 probably benign Het
Lctl C A 9: 64,118,887 Q75K probably benign Het
Ldb3 T A 14: 34,578,651 I89F possibly damaging Het
Lrrc49 A T 9: 60,677,095 L156Q probably damaging Het
Mark2 G T 19: 7,281,828 T83K probably benign Het
Ms4a15 A T 19: 10,980,210 D170E probably damaging Het
Msantd2 A G 9: 37,522,760 S99G possibly damaging Het
Nemf G T 12: 69,353,803 T124N probably benign Het
Nlrp9c A T 7: 26,394,136 F35I possibly damaging Het
Nwd2 A G 5: 63,804,773 I567V probably benign Het
Olfr111 A C 17: 37,530,642 I222L probably benign Het
Olfr1340 A G 4: 118,727,170 I308V probably null Het
Olfr323 T C 11: 58,625,740 Y102C probably damaging Het
Olfr828 T A 9: 18,815,994 Q100L probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pdk4 T C 6: 5,491,138 E209G probably benign Het
Plch1 T C 3: 63,710,978 Q712R probably damaging Het
Pnpla1 T A 17: 28,886,878 V569E possibly damaging Het
Prkar2a A T 9: 108,719,258 D134V probably damaging Het
Ptov1 T A 7: 44,864,622 Q40L possibly damaging Het
Ptprq T C 10: 107,708,728 I314V probably benign Het
Rabl2 T C 15: 89,583,966 K66E probably damaging Het
Rnf38 A G 4: 44,152,507 V19A possibly damaging Het
Scn2a T A 2: 65,682,091 W191R probably damaging Het
Sec22b T A 3: 97,921,256 F212I possibly damaging Het
Sec24c T A 14: 20,688,715 probably null Het
Sept2 T C 1: 93,495,599 S51P probably damaging Het
Serpinb1a T C 13: 32,848,656 N90S probably damaging Het
Slc1a2 C T 2: 102,743,863 T206I probably benign Het
Slc25a19 C A 11: 115,624,206 R42L probably damaging Het
St14 G A 9: 31,091,324 probably benign Het
Stxbp1 C T 2: 32,802,905 probably benign Het
Tas2r131 C T 6: 132,957,829 V6I probably benign Het
Tdo2 T A 3: 81,964,000 M235L probably benign Het
Tenm3 T G 8: 48,232,105 H2432P probably damaging Het
Tmprss15 C T 16: 79,024,742 probably benign Het
Tmx1 A G 12: 70,453,256 N30D probably benign Het
Tom1 A G 8: 75,064,392 probably null Het
Top2a T C 11: 99,022,955 N20S probably benign Het
Ttc23l T A 15: 10,539,963 T145S probably benign Het
Unc13b T A 4: 43,236,983 M3351K possibly damaging Het
Vmn1r47 T C 6: 90,022,659 S258P probably damaging Het
Vmn2r8 T G 5: 108,797,451 probably null Het
Vps11 T C 9: 44,353,838 Q641R probably null Het
Wapl T A 14: 34,692,324 I381N probably damaging Het
Zmym6 G A 4: 127,122,808 G794E probably damaging Het
Other mutations in Dvl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Dvl2 APN 11 70009584 missense possibly damaging 0.86
IGL01465:Dvl2 APN 11 70006354 missense probably damaging 1.00
IGL01920:Dvl2 APN 11 70008047 missense probably benign 0.02
IGL01985:Dvl2 APN 11 70008293 missense probably damaging 1.00
IGL02071:Dvl2 APN 11 70004800 splice site probably null
IGL02110:Dvl2 APN 11 70008016 splice site probably benign
IGL03132:Dvl2 APN 11 70005688 missense probably benign 0.01
R0076:Dvl2 UTSW 11 70008100 missense probably damaging 0.99
R0076:Dvl2 UTSW 11 70008100 missense probably damaging 0.99
R0331:Dvl2 UTSW 11 70006217 splice site probably benign
R1187:Dvl2 UTSW 11 70006136 missense probably benign 0.05
R1552:Dvl2 UTSW 11 70006372 missense possibly damaging 0.92
R1726:Dvl2 UTSW 11 70009461 missense probably benign
R3103:Dvl2 UTSW 11 70008869 missense possibly damaging 0.82
R4688:Dvl2 UTSW 11 70007518 missense possibly damaging 0.82
R4812:Dvl2 UTSW 11 70011293 utr 3 prime probably benign
R5319:Dvl2 UTSW 11 70008131 missense possibly damaging 0.91
R5521:Dvl2 UTSW 11 70006407 missense probably damaging 0.98
R5647:Dvl2 UTSW 11 70009449 missense possibly damaging 0.91
R5721:Dvl2 UTSW 11 70005993 missense possibly damaging 0.95
R6053:Dvl2 UTSW 11 70005993 missense possibly damaging 0.95
R6812:Dvl2 UTSW 11 70000995 missense probably damaging 1.00
R6818:Dvl2 UTSW 11 70009273 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGTTTTGAGTCTCGCCACACAG -3'
(R):5'- AGATGGCTCTAATCTCCGCACAGC -3'

Sequencing Primer
(F):5'- CTAGCGCGTCAGTTTGC -3'
(R):5'- ATAACCTCAAGCATCACTTCTTTG -3'
Posted On2013-04-16