Incidental Mutation 'T0722:Toe1'
ID262093
Institutional Source Beutler Lab
Gene Symbol Toe1
Ensembl Gene ENSMUSG00000028688
Gene Nametarget of EGR1, member 1 (nuclear)
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock #T0722 (G3) of strain 711
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location116794310-116807640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116806093 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 62 (I62M)
Ref Sequence ENSEMBL: ENSMUSP00000117019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030451] [ENSMUST00000045542] [ENSMUST00000102699] [ENSMUST00000106455] [ENSMUST00000106456] [ENSMUST00000106459] [ENSMUST00000130359] [ENSMUST00000145468]
Predicted Effect probably benign
Transcript: ENSMUST00000030451
AA Change: I128M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030451
Gene: ENSMUSG00000028688
AA Change: I128M

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 39 171 3.1e-46 PFAM
Pfam:CAF1 164 452 9.9e-40 PFAM
Pfam:zf-CCCH 297 322 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045542
SMART Domains Protein: ENSMUSP00000041009
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase 59 309 1.6e-48 PFAM
Pfam:Pkinase_Tyr 59 309 1.2e-50 PFAM
low complexity region 539 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102699
SMART Domains Protein: ENSMUSP00000099760
Gene: ENSMUSG00000028687

DomainStartEndE-ValueType
ENDO3c 107 259 1.46e-52 SMART
FES 260 280 2.16e-5 SMART
Pfam:NUDIX_4 353 463 2.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106455
AA Change: I128M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102063
Gene: ENSMUSG00000028688
AA Change: I128M

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 37 301 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106456
SMART Domains Protein: ENSMUSP00000102064
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 291 4.5e-46 PFAM
Pfam:Pkinase 60 332 3.6e-46 PFAM
low complexity region 510 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106459
SMART Domains Protein: ENSMUSP00000102067
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 238 6.1e-37 PFAM
Pfam:Pkinase 60 239 4.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124857
Predicted Effect probably benign
Transcript: ENSMUST00000130359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142529
Predicted Effect probably benign
Transcript: ENSMUST00000145468
AA Change: I62M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117019
Gene: ENSMUSG00000028688
AA Change: I62M

DomainStartEndE-ValueType
Pfam:CAF1 1 184 2.2e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154945
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A G 12: 113,489,577 T5A possibly damaging Het
Adam6b T A 12: 113,491,268 D568E probably benign Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 T G 4: 126,404,296 T144P probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Atp6v1g3 T A 1: 138,273,853 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bicd2 C A 13: 49,379,651 P571Q probably benign Het
Camta2 A G 11: 70,684,005 I75T probably damaging Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cdk5r1 G T 11: 80,477,881 V125F probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Cngb1 A G 8: 95,296,650 M240T probably benign Het
Cngb1 G T 8: 95,297,819 Q205K probably damaging Het
Cngb1 T C 8: 95,303,696 probably benign Het
Cngb1 G A 8: 95,303,714 probably benign Het
Cog8 G T 8: 107,048,993 L580I probably benign Het
Copa A G 1: 172,111,948 E593G possibly damaging Het
Ctrc T TA 4: 141,845,196 probably null Het
Cwf19l2 T C 9: 3,456,755 F696S probably benign Het
Ddi2 G A 4: 141,713,473 probably benign Het
Eml5 T C 12: 98,841,582 D984G probably null Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Fstl3 A G 10: 79,780,163 Y161C probably damaging Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm8186 C T 17: 26,099,127 R32Q probably benign Het
Gm8394 A G 10: 85,313,593 noncoding transcript Het
Jakmip1 C A 5: 37,118,903 A519D probably damaging Het
Jcad G T 18: 4,675,531 A1098S probably benign Het
Klhl14 T C 18: 21,558,135 Y446C probably damaging Het
Lims1 A G 10: 58,418,455 N344D probably benign Het
Marco A T 1: 120,474,712 W502R probably damaging Het
Mmp13 G T 9: 7,280,857 M413I possibly damaging Het
Mmp25 G A 17: 23,631,218 A456V possibly damaging Het
Msi2 A T 11: 88,394,597 M207K probably damaging Het
Myh8 G A 11: 67,304,436 R1692Q probably benign Het
Nbas A G 12: 13,352,808 I788V probably benign Het
Nup188 A G 2: 30,322,681 D632G probably damaging Het
Olfr1141 T A 2: 87,753,123 Y290F probably damaging Het
Olfr1219 A G 2: 89,074,959 V44A probably benign Het
Olfr354 T C 2: 36,907,570 V208A probably benign Het
Olfr360 T G 2: 37,068,437 L44R probably damaging Het
Opa1 T C 16: 29,610,930 probably null Het
Pabpc1l G A 2: 164,042,420 G359D possibly damaging Het
Papd7 G A 13: 69,506,955 R224* probably null Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Qser1 A G 2: 104,786,832 C1122R possibly damaging Het
Rfx8 A G 1: 39,683,612 S282P probably damaging Het
Sec14l2 C T 11: 4,103,673 probably null Het
Sim2 C A 16: 94,109,422 H228N probably benign Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc30a6 T A 17: 74,412,324 probably null Het
Smarcc1 G A 9: 110,206,085 E859K possibly damaging Het
Snx1 CTT CTTGTT 9: 66,104,927 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Spta1 A G 1: 174,191,066 probably benign Het
Sytl1 C A 4: 133,256,851 probably benign Het
Sytl1 A G 4: 133,256,853 probably benign Het
Terf2 T C 8: 107,076,674 K425E probably benign Het
Tmem26 A G 10: 68,778,718 E321G probably benign Het
Uck2 A T 1: 167,234,711 D149E probably benign Het
Wnt5a G A 14: 28,511,925 A17T probably benign Het
Yif1b T C 7: 29,238,613 probably null Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Toe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Toe1 APN 4 116806330 missense possibly damaging 0.83
F5770:Toe1 UTSW 4 116806111 missense probably damaging 1.00
R0501:Toe1 UTSW 4 116807485 missense probably benign
R0639:Toe1 UTSW 4 116806750 missense probably benign
R1768:Toe1 UTSW 4 116804879 missense probably benign 0.04
R1860:Toe1 UTSW 4 116805229 missense probably damaging 1.00
R2926:Toe1 UTSW 4 116804980 missense possibly damaging 0.67
R4722:Toe1 UTSW 4 116805200 missense probably damaging 1.00
R4926:Toe1 UTSW 4 116804532 missense probably damaging 0.99
R5195:Toe1 UTSW 4 116804655 missense probably damaging 1.00
R6898:Toe1 UTSW 4 116807474 missense probably damaging 1.00
T0975:Toe1 UTSW 4 116806093 missense probably benign 0.00
V7581:Toe1 UTSW 4 116806111 missense probably damaging 1.00
V7582:Toe1 UTSW 4 116806111 missense probably damaging 1.00
V7583:Toe1 UTSW 4 116806111 missense probably damaging 1.00
X0028:Toe1 UTSW 4 116806052 missense probably damaging 1.00
Predicted Primers
Posted On2015-02-04