Incidental Mutation 'T0722:Zmym1'
ID262100
Institutional Source Beutler Lab
Gene Symbol Zmym1
Ensembl Gene ENSMUSG00000043872
Gene Namezinc finger, MYM domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #T0722 (G3) of strain 711
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location127047094-127061152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127047947 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 785 (D785N)
Ref Sequence ENSEMBL: ENSMUSP00000101705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055013] [ENSMUST00000106099] [ENSMUST00000106102]
Predicted Effect probably benign
Transcript: ENSMUST00000055013
AA Change: D883N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050669
Gene: ENSMUSG00000043872
AA Change: D883N

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 2.4e-8 PFAM
Pfam:zf-FCS 53 96 1.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:DUF4371 335 569 4.9e-55 PFAM
Pfam:Dimer_Tnp_hAT 870 959 5.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106099
AA Change: D785N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101705
Gene: ENSMUSG00000043872
AA Change: D785N

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 3.3e-9 PFAM
Pfam:zf-FCS 53 96 4.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
Pfam:DUF4371 237 471 2.8e-52 PFAM
Pfam:Dimer_Tnp_hAT 772 861 5.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106102
AA Change: D883N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101708
Gene: ENSMUSG00000043872
AA Change: D883N

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 7.8e-9 PFAM
Pfam:zf-FCS 53 96 1.1e-9 PFAM
low complexity region 155 168 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:DUF4371 335 569 7.4e-52 PFAM
Pfam:Dimer_Tnp_hAT 870 959 1.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152607
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A G 12: 113,489,577 T5A possibly damaging Het
Adam6b T A 12: 113,491,268 D568E probably benign Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 T G 4: 126,404,296 T144P probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Atp6v1g3 T A 1: 138,273,853 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bicd2 C A 13: 49,379,651 P571Q probably benign Het
Camta2 A G 11: 70,684,005 I75T probably damaging Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cdk5r1 G T 11: 80,477,881 V125F probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Cngb1 A G 8: 95,296,650 M240T probably benign Het
Cngb1 G T 8: 95,297,819 Q205K probably damaging Het
Cngb1 T C 8: 95,303,696 probably benign Het
Cngb1 G A 8: 95,303,714 probably benign Het
Cog8 G T 8: 107,048,993 L580I probably benign Het
Copa A G 1: 172,111,948 E593G possibly damaging Het
Ctrc T TA 4: 141,845,196 probably null Het
Cwf19l2 T C 9: 3,456,755 F696S probably benign Het
Ddi2 G A 4: 141,713,473 probably benign Het
Eml5 T C 12: 98,841,582 D984G probably null Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Fstl3 A G 10: 79,780,163 Y161C probably damaging Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm8186 C T 17: 26,099,127 R32Q probably benign Het
Gm8394 A G 10: 85,313,593 noncoding transcript Het
Jakmip1 C A 5: 37,118,903 A519D probably damaging Het
Jcad G T 18: 4,675,531 A1098S probably benign Het
Klhl14 T C 18: 21,558,135 Y446C probably damaging Het
Lims1 A G 10: 58,418,455 N344D probably benign Het
Marco A T 1: 120,474,712 W502R probably damaging Het
Mmp13 G T 9: 7,280,857 M413I possibly damaging Het
Mmp25 G A 17: 23,631,218 A456V possibly damaging Het
Msi2 A T 11: 88,394,597 M207K probably damaging Het
Myh8 G A 11: 67,304,436 R1692Q probably benign Het
Nbas A G 12: 13,352,808 I788V probably benign Het
Nup188 A G 2: 30,322,681 D632G probably damaging Het
Olfr1141 T A 2: 87,753,123 Y290F probably damaging Het
Olfr1219 A G 2: 89,074,959 V44A probably benign Het
Olfr354 T C 2: 36,907,570 V208A probably benign Het
Olfr360 T G 2: 37,068,437 L44R probably damaging Het
Opa1 T C 16: 29,610,930 probably null Het
Pabpc1l G A 2: 164,042,420 G359D possibly damaging Het
Papd7 G A 13: 69,506,955 R224* probably null Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Qser1 A G 2: 104,786,832 C1122R possibly damaging Het
Rfx8 A G 1: 39,683,612 S282P probably damaging Het
Sec14l2 C T 11: 4,103,673 probably null Het
Sim2 C A 16: 94,109,422 H228N probably benign Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc30a6 T A 17: 74,412,324 probably null Het
Smarcc1 G A 9: 110,206,085 E859K possibly damaging Het
Snx1 CTT CTTGTT 9: 66,104,927 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Spta1 A G 1: 174,191,066 probably benign Het
Sytl1 C A 4: 133,256,851 probably benign Het
Sytl1 A G 4: 133,256,853 probably benign Het
Terf2 T C 8: 107,076,674 K425E probably benign Het
Tmem26 A G 10: 68,778,718 E321G probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Uck2 A T 1: 167,234,711 D149E probably benign Het
Wnt5a G A 14: 28,511,925 A17T probably benign Het
Yif1b T C 7: 29,238,613 probably null Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Other mutations in Zmym1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Zmym1 APN 4 127049642 missense probably damaging 1.00
IGL02326:Zmym1 APN 4 127047760 missense probably damaging 1.00
IGL02392:Zmym1 APN 4 127048463 missense probably damaging 1.00
IGL02431:Zmym1 APN 4 127047764 nonsense probably null
IGL02512:Zmym1 APN 4 127048672 missense probably damaging 1.00
IGL03303:Zmym1 APN 4 127049134 missense probably damaging 1.00
R0195:Zmym1 UTSW 4 127047911 missense possibly damaging 0.85
R0266:Zmym1 UTSW 4 127048025 missense possibly damaging 0.86
R0416:Zmym1 UTSW 4 127058820 missense probably benign 0.00
R1374:Zmym1 UTSW 4 127049611 missense probably damaging 1.00
R1480:Zmym1 UTSW 4 127048612 missense probably damaging 0.99
R1704:Zmym1 UTSW 4 127048384 missense probably damaging 1.00
R1806:Zmym1 UTSW 4 127048079 missense probably damaging 1.00
R1815:Zmym1 UTSW 4 127049021 missense possibly damaging 0.76
R2124:Zmym1 UTSW 4 127049570 missense probably benign 0.05
R2169:Zmym1 UTSW 4 127054203 splice site probably null
R4027:Zmym1 UTSW 4 127049879 missense probably benign 0.08
R4410:Zmym1 UTSW 4 127048104 nonsense probably null
R4572:Zmym1 UTSW 4 127050835 missense probably benign 0.39
R4788:Zmym1 UTSW 4 127054297 missense probably benign 0.10
R5120:Zmym1 UTSW 4 127051437 splice site probably null
R5130:Zmym1 UTSW 4 127048658 missense probably damaging 1.00
R5615:Zmym1 UTSW 4 127049398 missense probably damaging 1.00
R6190:Zmym1 UTSW 4 127047884 missense probably damaging 0.99
T0722:Zmym1 UTSW 4 127048250 missense probably benign 0.01
T0722:Zmym1 UTSW 4 127049673 missense probably benign 0.05
T0975:Zmym1 UTSW 4 127047947 missense probably benign 0.00
T0975:Zmym1 UTSW 4 127048250 missense probably benign 0.01
T0975:Zmym1 UTSW 4 127049673 missense probably benign 0.05
Predicted Primers
Posted On2015-02-04