Incidental Mutation 'T0722:Azin2'
ID262104
Institutional Source Beutler Lab
Gene Symbol Azin2
Ensembl Gene ENSMUSG00000028789
Gene Nameantizyme inhibitor 2
SynonymsAZIN2, Odcp, 4933429I20Rik, Adc
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #T0722 (G3) of strain 711
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location128930233-128962442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128946134 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 222 (Y222H)
Ref Sequence ENSEMBL: ENSMUSP00000114086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030581] [ENSMUST00000106068] [ENSMUST00000119354] [ENSMUST00000147731]
Predicted Effect probably benign
Transcript: ENSMUST00000030581
AA Change: Y317H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030581
Gene: ENSMUSG00000028789
AA Change: Y317H

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 45 283 1.9e-69 PFAM
Pfam:Orn_DAP_Arg_deC 286 407 1.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106068
AA Change: Y317H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101683
Gene: ENSMUSG00000028789
AA Change: Y317H

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 45 283 6.7e-73 PFAM
Pfam:Orn_DAP_Arg_deC 287 406 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119354
AA Change: Y222H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114086
Gene: ENSMUSG00000028789
AA Change: Y222H

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 1 188 4.2e-54 PFAM
Pfam:Orn_DAP_Arg_deC 191 312 4.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143912
Predicted Effect probably benign
Transcript: ENSMUST00000147731
SMART Domains Protein: ENSMUSP00000122240
Gene: ENSMUSG00000028789

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 2 202 4e-56 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 2, the second member of this gene family. Like antizyme inhibitor 1, antizyme inhibitor 2 interacts with all 3 antizymes and stimulates ODC activity and polyamine uptake. However, unlike antizyme inhibitor 1, which is ubiquitously expressed and localized in the nucleus and cytoplasm, antizyme inhibitor 2 is predominantly expressed in the brain and testis and localized in the endoplasmic reticulum-golgi intermediate compartment. Recent studies indicate that antizyme inhibitor 2 is also expressed in specific cell types in ovaries, adrenal glands and pancreas, and in mast cells. The exact function of this gene is not known, however, available data suggest its role in cell growth, spermiogenesis, vesicular trafficking and secretion. There has been confusion in literature and databases over the nomenclature of this gene, stemming from an earlier report that a human cDNA clone (identical to ODCp/AZIN2) had arginine decarboxylase (ADC) activity (PMID:14738999). Subsequent studies in human and mouse showed that antizyme inhibitor 2 was devoid of arginine decarboxylase activity (PMID:19956990). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased circulating insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A G 12: 113,489,577 T5A possibly damaging Het
Adam6b T A 12: 113,491,268 D568E probably benign Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 T G 4: 126,404,296 T144P probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Atp6v1g3 T A 1: 138,273,853 probably benign Het
Bicd2 C A 13: 49,379,651 P571Q probably benign Het
Camta2 A G 11: 70,684,005 I75T probably damaging Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cdk5r1 G T 11: 80,477,881 V125F probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Cngb1 A G 8: 95,296,650 M240T probably benign Het
Cngb1 G T 8: 95,297,819 Q205K probably damaging Het
Cngb1 T C 8: 95,303,696 probably benign Het
Cngb1 G A 8: 95,303,714 probably benign Het
Cog8 G T 8: 107,048,993 L580I probably benign Het
Copa A G 1: 172,111,948 E593G possibly damaging Het
Ctrc T TA 4: 141,845,196 probably null Het
Cwf19l2 T C 9: 3,456,755 F696S probably benign Het
Ddi2 G A 4: 141,713,473 probably benign Het
Eml5 T C 12: 98,841,582 D984G probably null Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Fstl3 A G 10: 79,780,163 Y161C probably damaging Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm8186 C T 17: 26,099,127 R32Q probably benign Het
Gm8394 A G 10: 85,313,593 noncoding transcript Het
Jakmip1 C A 5: 37,118,903 A519D probably damaging Het
Jcad G T 18: 4,675,531 A1098S probably benign Het
Klhl14 T C 18: 21,558,135 Y446C probably damaging Het
Lims1 A G 10: 58,418,455 N344D probably benign Het
Marco A T 1: 120,474,712 W502R probably damaging Het
Mmp13 G T 9: 7,280,857 M413I possibly damaging Het
Mmp25 G A 17: 23,631,218 A456V possibly damaging Het
Msi2 A T 11: 88,394,597 M207K probably damaging Het
Myh8 G A 11: 67,304,436 R1692Q probably benign Het
Nbas A G 12: 13,352,808 I788V probably benign Het
Nup188 A G 2: 30,322,681 D632G probably damaging Het
Olfr1141 T A 2: 87,753,123 Y290F probably damaging Het
Olfr1219 A G 2: 89,074,959 V44A probably benign Het
Olfr354 T C 2: 36,907,570 V208A probably benign Het
Olfr360 T G 2: 37,068,437 L44R probably damaging Het
Opa1 T C 16: 29,610,930 probably null Het
Pabpc1l G A 2: 164,042,420 G359D possibly damaging Het
Papd7 G A 13: 69,506,955 R224* probably null Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Qser1 A G 2: 104,786,832 C1122R possibly damaging Het
Rfx8 A G 1: 39,683,612 S282P probably damaging Het
Sec14l2 C T 11: 4,103,673 probably null Het
Sim2 C A 16: 94,109,422 H228N probably benign Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc30a6 T A 17: 74,412,324 probably null Het
Smarcc1 G A 9: 110,206,085 E859K possibly damaging Het
Snx1 CTT CTTGTT 9: 66,104,927 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Spta1 A G 1: 174,191,066 probably benign Het
Sytl1 C A 4: 133,256,851 probably benign Het
Sytl1 A G 4: 133,256,853 probably benign Het
Terf2 T C 8: 107,076,674 K425E probably benign Het
Tmem26 A G 10: 68,778,718 E321G probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Uck2 A T 1: 167,234,711 D149E probably benign Het
Wnt5a G A 14: 28,511,925 A17T probably benign Het
Yif1b T C 7: 29,238,613 probably null Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Azin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Azin2 APN 4 128950666 missense probably damaging 1.00
IGL02040:Azin2 APN 4 128950658 missense possibly damaging 0.78
IGL03349:Azin2 APN 4 128946114 nonsense probably null
R0118:Azin2 UTSW 4 128949637 missense probably damaging 0.97
R1215:Azin2 UTSW 4 128949696 missense probably damaging 0.96
R1940:Azin2 UTSW 4 128950784 splice site probably null
R2939:Azin2 UTSW 4 128934604 missense probably benign 0.44
R4899:Azin2 UTSW 4 128934653 missense probably benign 0.43
R5836:Azin2 UTSW 4 128948877 missense probably damaging 1.00
R6511:Azin2 UTSW 4 128934466 missense probably damaging 1.00
T0975:Azin2 UTSW 4 128946134 missense probably benign 0.00
Predicted Primers
Posted On2015-02-04