Incidental Mutation 'T0722:Cog8'
ID262123
Institutional Source Beutler Lab
Gene Symbol Cog8
Ensembl Gene ENSMUSG00000031916
Gene Namecomponent of oligomeric golgi complex 8
SynonymsC87832
Accession Numbers

Genbank: NM_139229; MGI: 2142885

Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #T0722 (G3) of strain 711
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location107046289-107056689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 107048993 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 580 (L580I)
Ref Sequence ENSEMBL: ENSMUSP00000093173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034388] [ENSMUST00000034391] [ENSMUST00000055316] [ENSMUST00000095517]
Predicted Effect probably benign
Transcript: ENSMUST00000034388
SMART Domains Protein: ENSMUSP00000034388
Gene: ENSMUSG00000031913

DomainStartEndE-ValueType
MIT 2 80 2.02e-27 SMART
low complexity region 90 102 N/A INTRINSIC
AAA 159 295 2.89e-22 SMART
Blast:AAA 329 358 8e-9 BLAST
Pfam:Vps4_C 374 434 1.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034391
AA Change: L580I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034391
Gene: ENSMUSG00000031916
AA Change: L580I

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:Dor1 56 394 7.6e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055316
SMART Domains Protein: ENSMUSP00000138676
Gene: ENSMUSG00000078931

DomainStartEndE-ValueType
Pfam:Pep_deformylase 52 222 2.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095517
AA Change: L580I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093173
Gene: ENSMUSG00000031916
AA Change: L580I

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:Dor1 56 394 7.6e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122903
Predicted Effect probably benign
Transcript: ENSMUST00000134772
Predicted Effect probably benign
Transcript: ENSMUST00000154271
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a component of the conserved oligomeric Golgi (COG) complex, a multiprotein complex that plays a structural role in the Golgi apparatus, and is involved in intracellular membrane trafficking and glycoprotein modification. Mutations in this gene cause congenital disorder of glycosylation, type IIh, a disease that is characterized by under-glycosylated serum proteins, and whose symptoms include severe psychomotor retardation, failure to thrive, seizures, and dairy and wheat product intolerance. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(22) : Targeted, other(2) Gene trapped(20)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A G 12: 113,489,577 T5A possibly damaging Het
Adam6b T A 12: 113,491,268 D568E probably benign Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 T G 4: 126,404,296 T144P probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Atp6v1g3 T A 1: 138,273,853 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bicd2 C A 13: 49,379,651 P571Q probably benign Het
Camta2 A G 11: 70,684,005 I75T probably damaging Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cdk5r1 G T 11: 80,477,881 V125F probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Cngb1 A G 8: 95,296,650 M240T probably benign Het
Cngb1 G T 8: 95,297,819 Q205K probably damaging Het
Cngb1 T C 8: 95,303,696 probably benign Het
Cngb1 G A 8: 95,303,714 probably benign Het
Copa A G 1: 172,111,948 E593G possibly damaging Het
Ctrc T TA 4: 141,845,196 probably null Het
Cwf19l2 T C 9: 3,456,755 F696S probably benign Het
Ddi2 G A 4: 141,713,473 probably benign Het
Eml5 T C 12: 98,841,582 D984G probably null Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Fstl3 A G 10: 79,780,163 Y161C probably damaging Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm8186 C T 17: 26,099,127 R32Q probably benign Het
Gm8394 A G 10: 85,313,593 noncoding transcript Het
Jakmip1 C A 5: 37,118,903 A519D probably damaging Het
Jcad G T 18: 4,675,531 A1098S probably benign Het
Klhl14 T C 18: 21,558,135 Y446C probably damaging Het
Lims1 A G 10: 58,418,455 N344D probably benign Het
Marco A T 1: 120,474,712 W502R probably damaging Het
Mmp13 G T 9: 7,280,857 M413I possibly damaging Het
Mmp25 G A 17: 23,631,218 A456V possibly damaging Het
Msi2 A T 11: 88,394,597 M207K probably damaging Het
Myh8 G A 11: 67,304,436 R1692Q probably benign Het
Nbas A G 12: 13,352,808 I788V probably benign Het
Nup188 A G 2: 30,322,681 D632G probably damaging Het
Olfr1141 T A 2: 87,753,123 Y290F probably damaging Het
Olfr1219 A G 2: 89,074,959 V44A probably benign Het
Olfr354 T C 2: 36,907,570 V208A probably benign Het
Olfr360 T G 2: 37,068,437 L44R probably damaging Het
Opa1 T C 16: 29,610,930 probably null Het
Pabpc1l G A 2: 164,042,420 G359D possibly damaging Het
Papd7 G A 13: 69,506,955 R224* probably null Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Qser1 A G 2: 104,786,832 C1122R possibly damaging Het
Rfx8 A G 1: 39,683,612 S282P probably damaging Het
Sec14l2 C T 11: 4,103,673 probably null Het
Sim2 C A 16: 94,109,422 H228N probably benign Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc30a6 T A 17: 74,412,324 probably null Het
Smarcc1 G A 9: 110,206,085 E859K possibly damaging Het
Snx1 CTT CTTGTT 9: 66,104,927 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Spta1 A G 1: 174,191,066 probably benign Het
Sytl1 C A 4: 133,256,851 probably benign Het
Sytl1 A G 4: 133,256,853 probably benign Het
Terf2 T C 8: 107,076,674 K425E probably benign Het
Tmem26 A G 10: 68,778,718 E321G probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Uck2 A T 1: 167,234,711 D149E probably benign Het
Wnt5a G A 14: 28,511,925 A17T probably benign Het
Yif1b T C 7: 29,238,613 probably null Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Cog8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Cog8 APN 8 107054065 missense probably benign 0.23
IGL01959:Cog8 APN 8 107056378 missense probably damaging 1.00
IGL02563:Cog8 APN 8 107056423 missense possibly damaging 0.70
IGL02961:Cog8 APN 8 107056253 unclassified probably benign
R0076:Cog8 UTSW 8 107054133 missense possibly damaging 0.96
R0255:Cog8 UTSW 8 107049145 unclassified probably benign
R0433:Cog8 UTSW 8 107056478 missense possibly damaging 0.52
R0990:Cog8 UTSW 8 107052487 unclassified probably null
R1457:Cog8 UTSW 8 107052896 missense probably damaging 1.00
R1567:Cog8 UTSW 8 107054108 nonsense probably null
R2239:Cog8 UTSW 8 107056361 missense probably damaging 1.00
R2380:Cog8 UTSW 8 107056361 missense probably damaging 1.00
R2910:Cog8 UTSW 8 107054221 missense probably benign 0.25
R3978:Cog8 UTSW 8 107053037 missense probably damaging 1.00
R4560:Cog8 UTSW 8 107052211 critical splice donor site probably null
R4863:Cog8 UTSW 8 107050174 missense probably damaging 1.00
R4879:Cog8 UTSW 8 107056352 missense probably damaging 0.99
R5026:Cog8 UTSW 8 107049125 missense probably benign
R5721:Cog8 UTSW 8 107050148 missense probably benign 0.00
R6489:Cog8 UTSW 8 107050301 missense probably benign 0.00
Predicted Primers
Posted On2015-02-04