Incidental Mutation 'T0975:Pomgnt1'
ID262135
Institutional Source Beutler Lab
Gene Symbol Pomgnt1
Ensembl Gene ENSMUSG00000028700
Gene Nameprotein O-linked mannose beta 1,2-N-acetylglucosaminyltransferase
Synonyms0610016I07Rik, 4930467B06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #T0975 (G3) of strain 714
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location116123840-116159849 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 116137427 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030469] [ENSMUST00000120083] [ENSMUST00000121052]
Predicted Effect silent
Transcript: ENSMUST00000030469
SMART Domains Protein: ENSMUSP00000030469
Gene: ENSMUSG00000028701

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:LURAP 39 159 1.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120083
SMART Domains Protein: ENSMUSP00000112751
Gene: ENSMUSG00000028700

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
Pfam:ILEI 129 220 8.9e-28 PFAM
Pfam:GNT-I 293 612 1.9e-51 PFAM
low complexity region 645 658 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121052
SMART Domains Protein: ENSMUSP00000112911
Gene: ENSMUSG00000028700

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
PDB:2YOQ|C 129 217 6e-10 PDB
Pfam:GNT-I 293 613 3.2e-52 PFAM
low complexity region 645 658 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144311
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane protein that resides in the Golgi apparatus. It participates in O-mannosyl glycosylation and is specific for alpha linked terminal mannose. Mutations in this gene may be associated with muscle-eye-brain disease and several congenital muscular dystrophies. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Feb 2014]
PHENOTYPE: Surviving homozygous null mice display a mild dystrophy despite a reduced muscle mass and myofiber number, impaired muscle regeneration and low proliferative activity of satellite cells. Mice homozygous for a gene trap allele show reduced fertility and multiple defects in muscle, eye and brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik TAA TAAA 11: 3,937,945 probably null Het
4930556J24Rik C T 11: 3,976,324 A27T unknown Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bpifb5 C A 2: 154,229,464 probably null Het
Ccdc157 C T 11: 4,146,246 A455T probably damaging Het
Ccng1 A C 11: 40,754,044 S9A probably benign Het
Cfh T C 1: 140,154,598 T164A probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Chrng T C 1: 87,210,626 S380P probably benign Het
Clspn ACGGCGGCGGCGGCG ACGGCGGCGGCGGCGGCGGCG 4: 126,566,437 probably benign Het
Ctrc T TA 4: 141,845,196 probably null Het
Cxxc1 C T 18: 74,220,921 R593C probably damaging Het
Dlgap1 T C 17: 70,516,955 S312P possibly damaging Het
Dnah10 A G 5: 124,763,066 S1255G probably benign Het
Dpep1 A T 8: 123,200,988 S388C probably damaging Het
Emid1 A C 11: 5,128,884 L353V probably benign Het
Emid1 T C 11: 5,144,386 T42A probably damaging Het
Epn3 A G 11: 94,491,907 probably null Het
Fam124b T C 1: 80,213,126 E180G probably benign Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Gatsl3 G C 11: 4,220,445 G147A probably benign Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm7534 GTG GTGCTG 4: 134,202,629 probably benign Het
Gm9972 GA GAA 11: 43,036,770 probably null Het
Hmmr G C 11: 40,723,416 N148K probably damaging Het
Homez C T 14: 54,857,339 R304K possibly damaging Het
Ifngr1 G A 10: 19,609,473 V407M probably damaging Het
Inpp5j G T 11: 3,502,527 T241N possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kremen1 C T 11: 5,195,105 A424T probably benign Het
Mat2b G A 11: 40,680,091 T302I probably benign Het
Mtmr3 C T 11: 4,488,441 R671K probably benign Het
Nacad GCAGGGTCAGGGTC GCAGGGTCAGGGTCAGGGTC 11: 6,599,750 probably benign Het
Nacad T C 11: 6,601,622 N523S probably benign Het
Nacad A G 11: 6,601,632 C520R probably benign Het
Nefh G A 11: 4,940,151 P823S probably benign Het
Nfrkb G C 9: 31,397,083 A230P probably benign Het
Nlrp4a A G 7: 26,449,637 E223G probably damaging Het
Notch3 T A 17: 32,146,417 Y1107F probably damaging Het
Olfr1331 G T 4: 118,869,303 R174M probably benign Het
Olfr309 A T 7: 86,306,284 Y276* probably null Het
Olfr781 A G 10: 129,333,445 D188G probably benign Het
Osm A G 11: 4,239,588 D124G probably benign Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Sytl1 TCTGC TC 4: 133,256,994 probably benign Het
Tcn2 G C 11: 3,923,487 F286L possibly damaging Het
Tg T C 15: 66,688,863 S10P probably benign Het
Tmprss7 C T 16: 45,680,733 R235Q probably benign Het
Tns3 G T 11: 8,451,146 L1051M probably benign Het
Tns3 T G 11: 8,479,518 E806A probably benign Het
Tns3 G A 11: 8,549,100 probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Txnrd2 A G 16: 18,475,565 H436R probably damaging Het
Ubr4 C T 4: 139,451,781 P2001S probably damaging Het
Vmn2r23 T A 6: 123,713,161 M332K probably benign Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zfyve21 A G 12: 111,827,633 D206G probably damaging Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Pomgnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Pomgnt1 APN 4 116152761 missense probably damaging 1.00
IGL02001:Pomgnt1 APN 4 116152908 nonsense probably null
IGL02582:Pomgnt1 APN 4 116158550 missense probably damaging 1.00
pomegranate UTSW 4 116154890 missense probably damaging 1.00
R0206:Pomgnt1 UTSW 4 116158560 critical splice donor site probably null
R0688:Pomgnt1 UTSW 4 116155889 missense probably damaging 1.00
R0890:Pomgnt1 UTSW 4 116152185 missense probably benign 0.25
R0927:Pomgnt1 UTSW 4 116151851 missense probably damaging 1.00
R1942:Pomgnt1 UTSW 4 116155275 splice site probably null
R1983:Pomgnt1 UTSW 4 116151869 missense probably damaging 1.00
R1983:Pomgnt1 UTSW 4 116151920 missense probably benign 0.12
R2034:Pomgnt1 UTSW 4 116157927 missense possibly damaging 0.87
R3721:Pomgnt1 UTSW 4 116153543 splice site probably benign
R3774:Pomgnt1 UTSW 4 116154128 missense probably damaging 1.00
R3775:Pomgnt1 UTSW 4 116154128 missense probably damaging 1.00
R3815:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R3816:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R3817:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R3818:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R4447:Pomgnt1 UTSW 4 116152923 missense possibly damaging 0.75
R4583:Pomgnt1 UTSW 4 116158494 missense probably benign 0.03
R4616:Pomgnt1 UTSW 4 116154890 missense probably damaging 1.00
R4690:Pomgnt1 UTSW 4 116155510 missense probably damaging 1.00
R4717:Pomgnt1 UTSW 4 116154215 missense possibly damaging 0.50
R4719:Pomgnt1 UTSW 4 116155775 missense probably damaging 1.00
R4747:Pomgnt1 UTSW 4 116156199 missense probably damaging 1.00
R5108:Pomgnt1 UTSW 4 116156256 intron probably benign
R5569:Pomgnt1 UTSW 4 116155967 missense probably damaging 1.00
R5821:Pomgnt1 UTSW 4 116155736 missense probably benign 0.16
R5937:Pomgnt1 UTSW 4 116153913 missense probably benign 0.01
R6052:Pomgnt1 UTSW 4 116151602 missense possibly damaging 0.91
R6745:Pomgnt1 UTSW 4 116153883 missense probably damaging 0.97
R6949:Pomgnt1 UTSW 4 116154154 missense probably damaging 0.97
T0722:Pomgnt1 UTSW 4 116137427 unclassified probably benign
Predicted Primers
Posted On2015-02-04