Incidental Mutation 'R0335:Rabl2'
ID26226
Institutional Source Beutler Lab
Gene Symbol Rabl2
Ensembl Gene ENSMUSG00000022621
Gene NameRAB, member RAS oncogene family-like 2
Synonyms1110031N17Rik, Rabl2a
MMRRC Submission 038544-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R0335 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89582533-89591923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89583966 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 66 (K66E)
Ref Sequence ENSEMBL: ENSMUSP00000091598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023294] [ENSMUST00000094056] [ENSMUST00000169466] [ENSMUST00000170126] [ENSMUST00000171580] [ENSMUST00000172053]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023294
AA Change: K151E

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023294
Gene: ENSMUSG00000022621
AA Change: K151E

DomainStartEndE-ValueType
Pfam:Arf 10 196 2.3e-12 PFAM
Pfam:MMR_HSR1 23 134 1.4e-6 PFAM
Pfam:Roc 23 137 2e-35 PFAM
Pfam:Gtr1_RagA 23 171 9e-8 PFAM
Pfam:Ras 23 180 3.8e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094056
AA Change: K66E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091598
Gene: ENSMUSG00000022621
AA Change: K66E

DomainStartEndE-ValueType
Blast:RAB 50 94 4e-10 BLAST
SCOP:d3raba_ 57 91 1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165747
Predicted Effect unknown
Transcript: ENSMUST00000169466
AA Change: E50G
SMART Domains Protein: ENSMUSP00000129660
Gene: ENSMUSG00000022621
AA Change: E50G

DomainStartEndE-ValueType
SCOP:d1ek0a_ 21 53 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170126
SMART Domains Protein: ENSMUSP00000126182
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
Pfam:Ras 23 74 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171142
Predicted Effect probably benign
Transcript: ENSMUST00000171580
SMART Domains Protein: ENSMUSP00000128799
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
SCOP:d1ek0a_ 21 38 7e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171826
AA Change: K27E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129221
Gene: ENSMUSG00000022621
AA Change: K27E

DomainStartEndE-ValueType
Blast:RAB 2 49 7e-16 BLAST
SCOP:d1fzqa_ 3 49 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172053
SMART Domains Protein: ENSMUSP00000129253
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
Pfam:Arf 10 100 6.5e-9 PFAM
Pfam:Miro 23 102 1.7e-11 PFAM
Pfam:Ras 23 102 4.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172074
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.6%
  • 20x: 87.5%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the RAB gene family which belongs to the RAS GTPase superfamily. The proteins in the family of RAS-related signaling molecules are small GTP-binding proteins that play important roles in the regulation of exocytotic and endocytotic pathways. This gene maps to the site of an ancestral telomere fusion event and may be a subtelomeric gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility, reduced testis weight, oligospermia, asthenozoospermia and short flagellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik A G 14: 12,301,266 E124G possibly damaging Het
4932438A13Rik T C 3: 36,969,152 V2210A probably damaging Het
Adamts12 G T 15: 11,311,058 D1134Y possibly damaging Het
Add3 A G 19: 53,236,828 T460A probably benign Het
Amer3 A C 1: 34,579,300 probably benign Het
Arhgap22 C T 14: 33,359,108 probably benign Het
Arhgap32 T G 9: 32,259,760 S1279A probably benign Het
Bcas1 G A 2: 170,418,681 T26M probably damaging Het
Begain A T 12: 109,038,934 F256I probably damaging Het
Cabin1 A T 10: 75,657,049 I1804N probably damaging Het
Cad G A 5: 31,073,985 probably benign Het
Carmil1 G A 13: 24,073,983 S762L probably damaging Het
Ccdc93 T A 1: 121,492,977 L529Q probably damaging Het
Cdh12 T A 15: 21,578,549 probably null Het
Clip2 T A 5: 134,535,215 probably benign Het
Cmip T C 8: 117,445,366 I480T probably damaging Het
Cnot1 A T 8: 95,772,000 I203K probably benign Het
Col18a1 G A 10: 77,059,363 P1155S probably damaging Het
Col1a2 T A 6: 4,531,956 probably benign Het
Crybg3 A T 16: 59,544,140 L2373Q probably damaging Het
D130043K22Rik A T 13: 24,887,877 I935F probably damaging Het
Dapl1 T A 2: 59,496,594 D61E possibly damaging Het
Def6 A G 17: 28,228,069 D558G possibly damaging Het
Dnah6 T C 6: 73,069,399 probably benign Het
Dvl2 G A 11: 70,001,035 probably benign Het
Ecd A C 14: 20,320,734 V639G probably benign Het
Epg5 C T 18: 77,986,472 T1350M probably benign Het
Erbb4 C A 1: 68,259,259 M657I probably benign Het
Evi5 T C 5: 107,812,411 R431G probably benign Het
Fbxo11 G A 17: 88,015,613 A115V possibly damaging Het
Fgfr2 T C 7: 130,196,249 T192A probably benign Het
Gas7 C T 11: 67,662,052 A146V possibly damaging Het
Gatad2b T A 3: 90,356,182 S529T probably benign Het
Gm10722 G T 9: 3,001,048 Q41H probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm7535 A G 17: 17,911,112 probably benign Het
Gstm1 T A 3: 108,012,696 N193I possibly damaging Het
Heatr5b G A 17: 78,827,946 P252L probably benign Het
Hmgb1 A G 5: 149,050,631 V36A probably benign Het
Hrh1 G T 6: 114,480,232 W158L probably damaging Het
Ighv6-4 T C 12: 114,406,674 M53V probably benign Het
Iqgap2 T A 13: 95,635,633 D1346V probably damaging Het
Kcng3 A T 17: 83,587,737 N433K possibly damaging Het
Kif1a T A 1: 93,052,566 probably benign Het
Lctl C A 9: 64,118,887 Q75K probably benign Het
Ldb3 T A 14: 34,578,651 I89F possibly damaging Het
Lrrc49 A T 9: 60,677,095 L156Q probably damaging Het
Mark2 G T 19: 7,281,828 T83K probably benign Het
Ms4a15 A T 19: 10,980,210 D170E probably damaging Het
Msantd2 A G 9: 37,522,760 S99G possibly damaging Het
Nemf G T 12: 69,353,803 T124N probably benign Het
Nlrp9c A T 7: 26,394,136 F35I possibly damaging Het
Nwd2 A G 5: 63,804,773 I567V probably benign Het
Olfr111 A C 17: 37,530,642 I222L probably benign Het
Olfr1340 A G 4: 118,727,170 I308V probably null Het
Olfr323 T C 11: 58,625,740 Y102C probably damaging Het
Olfr828 T A 9: 18,815,994 Q100L probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pdk4 T C 6: 5,491,138 E209G probably benign Het
Plch1 T C 3: 63,710,978 Q712R probably damaging Het
Pnpla1 T A 17: 28,886,878 V569E possibly damaging Het
Prkar2a A T 9: 108,719,258 D134V probably damaging Het
Ptov1 T A 7: 44,864,622 Q40L possibly damaging Het
Ptprq T C 10: 107,708,728 I314V probably benign Het
Rnf38 A G 4: 44,152,507 V19A possibly damaging Het
Scn2a T A 2: 65,682,091 W191R probably damaging Het
Sec22b T A 3: 97,921,256 F212I possibly damaging Het
Sec24c T A 14: 20,688,715 probably null Het
Sept2 T C 1: 93,495,599 S51P probably damaging Het
Serpinb1a T C 13: 32,848,656 N90S probably damaging Het
Slc1a2 C T 2: 102,743,863 T206I probably benign Het
Slc25a19 C A 11: 115,624,206 R42L probably damaging Het
St14 G A 9: 31,091,324 probably benign Het
Stxbp1 C T 2: 32,802,905 probably benign Het
Tas2r131 C T 6: 132,957,829 V6I probably benign Het
Tdo2 T A 3: 81,964,000 M235L probably benign Het
Tenm3 T G 8: 48,232,105 H2432P probably damaging Het
Tmprss15 C T 16: 79,024,742 probably benign Het
Tmx1 A G 12: 70,453,256 N30D probably benign Het
Tom1 A G 8: 75,064,392 probably null Het
Top2a T C 11: 99,022,955 N20S probably benign Het
Ttc23l T A 15: 10,539,963 T145S probably benign Het
Unc13b T A 4: 43,236,983 M3351K possibly damaging Het
Vmn1r47 T C 6: 90,022,659 S258P probably damaging Het
Vmn2r8 T G 5: 108,797,451 probably null Het
Vps11 T C 9: 44,353,838 Q641R probably null Het
Wapl T A 14: 34,692,324 I381N probably damaging Het
Zmym6 G A 4: 127,122,808 G794E probably damaging Het
Other mutations in Rabl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Rabl2 APN 15 89590270 splice site probably benign
IGL01612:Rabl2 APN 15 89583412 missense probably benign 0.05
IGL02317:Rabl2 APN 15 89584289 missense probably damaging 1.00
R4169:Rabl2 UTSW 15 89590379 start codon destroyed probably null 0.98
R4276:Rabl2 UTSW 15 89584188 intron probably benign
R4330:Rabl2 UTSW 15 89586934 missense probably benign 0.09
R5657:Rabl2 UTSW 15 89588213 missense probably benign 0.00
R6242:Rabl2 UTSW 15 89584352 missense probably benign
X0023:Rabl2 UTSW 15 89583980 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCCCAGCTTTATAACCAGCAGTCTC -3'
(R):5'- CAAAGAATGGCCCACCTTTGTTTCC -3'

Sequencing Primer
(F):5'- TTTATAACCAGCAGTCTCACCCC -3'
(R):5'- CAAGATGCTCCCTTTCTAGTAGG -3'
Posted On2013-04-16