Incidental Mutation 'R0812:Tk1'
ID262309
Institutional Source Beutler Lab
Gene Symbol Tk1
Ensembl Gene ENSMUSG00000025574
Gene Namethymidine kinase 1
SynonymsD530002A18Rik, Tk-1
MMRRC Submission 038992-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0812 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location117815526-117826092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117822107 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 98 (E98G)
Ref Sequence ENSEMBL: ENSMUSP00000026661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026661] [ENSMUST00000073388] [ENSMUST00000132298] [ENSMUST00000149668]
Predicted Effect probably damaging
Transcript: ENSMUST00000026661
AA Change: E98G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026661
Gene: ENSMUSG00000025574
AA Change: E98G

DomainStartEndE-ValueType
Pfam:TK 19 189 9.8e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073388
SMART Domains Protein: ENSMUSP00000073102
Gene: ENSMUSG00000017718

DomainStartEndE-ValueType
Pfam:COesterase 34 139 1.1e-6 PFAM
Pfam:Abhydrolase_5 88 280 4.1e-12 PFAM
Pfam:Abhydrolase_3 89 283 7.8e-19 PFAM
Pfam:Peptidase_S9 106 296 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129852
Predicted Effect probably benign
Transcript: ENSMUST00000132298
SMART Domains Protein: ENSMUSP00000135368
Gene: ENSMUSG00000093485

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
low complexity region 90 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149668
SMART Domains Protein: ENSMUSP00000119310
Gene: ENSMUSG00000017718

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 80 272 9.1e-12 PFAM
Pfam:Abhydrolase_3 81 273 1.7e-17 PFAM
Pfam:Peptidase_S9 101 287 2.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154790
Meta Mutation Damage Score 0.502 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.8%
  • 20x: 91.7%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytosolic enzyme that catalyzes the addition of a gamma-phosphate group to thymidine. This creates dTMP and is the first step in the biosynthesis of dTTP, which is one component required for DNA replication. The encoded protein, whose levels fluctuate depending on the cell cycle stage, can act as a low activity dimer or a high activity tetramer. High levels of this protein have been used as a biomarker for diagnosing and categorizing many types of cancers. [provided by RefSeq, Oct 2016]
PHENOTYPE: Nullizygous mice show partial postnatal lethality, poor fertility, hemosiderosis, lymphocyte and spleen anomalies, altered sublingual gland secretion, inflammation of the arteries, lung, liver and thyroid, abnormal spermatogenesis and glomerulosclerosis leading to kidney failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,713,414 F858S probably damaging Het
Abcb1a T C 5: 8,713,229 S586P probably damaging Het
Abcc3 G A 11: 94,375,202 probably benign Het
Ap5z1 G A 5: 142,475,791 R583H probably benign Het
Arrb1 G T 7: 99,598,501 V346L probably benign Het
Atrnl1 T A 19: 57,673,141 F518I probably benign Het
Bank1 T A 3: 136,093,366 I405F probably damaging Het
Cacna1c A G 6: 118,630,263 C1227R probably benign Het
Cacna1h A G 17: 25,388,628 L905P probably damaging Het
Cc2d1a A G 8: 84,133,836 Y826H probably benign Het
Cenpo A G 12: 4,216,643 V155A probably benign Het
Cnmd A G 14: 79,661,423 F63S probably damaging Het
Cnn3 G A 3: 121,454,951 G72D probably damaging Het
Cox10 A G 11: 64,071,713 S101P probably benign Het
Ctdsp1 T C 1: 74,394,647 V129A probably damaging Het
Cyp2d34 A T 15: 82,618,606 S140T probably benign Het
Dennd5a G A 7: 109,933,613 H317Y possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Enox1 T A 14: 77,582,436 D210E probably damaging Het
Fam171a1 A G 2: 3,197,427 N190S probably damaging Het
Fat2 T A 11: 55,253,633 K4138N possibly damaging Het
Fat4 A T 3: 38,957,474 D2241V probably damaging Het
Fbn1 C T 2: 125,403,170 V266I possibly damaging Het
Foxf2 T A 13: 31,627,205 Y376N probably damaging Het
Fras1 T A 5: 96,752,998 S3025R probably benign Het
Gba T C 3: 89,204,000 I24T probably benign Het
Gdpd5 A G 7: 99,438,333 D68G probably damaging Het
Grid1 G A 14: 34,822,619 S49N probably benign Het
Grtp1 T C 8: 13,179,639 T250A possibly damaging Het
Gucy1b1 T C 3: 82,037,988 N448D probably benign Het
H2-Ob A G 17: 34,244,126 probably benign Het
Hcn4 A G 9: 58,823,512 M1V probably null Het
Hmcn2 G A 2: 31,420,371 A3326T probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,257,939 probably benign Het
Ippk C A 13: 49,443,471 Q254K probably damaging Het
Itga2 A T 13: 114,870,614 L393I possibly damaging Het
Kcna10 A T 3: 107,195,259 E402V possibly damaging Het
Kcnab1 G A 3: 65,297,720 D119N probably damaging Het
Kcnip4 T A 5: 48,409,860 T122S probably benign Het
Kcnma1 G A 14: 23,300,018 P1151L probably damaging Het
Klhl22 T A 16: 17,792,589 M568K probably benign Het
Krt6a C T 15: 101,692,748 V257M probably damaging Het
Ksr2 A C 5: 117,555,225 H246P probably damaging Het
Lca5 T C 9: 83,399,753 D326G possibly damaging Het
Lcp1 A G 14: 75,214,488 E393G probably benign Het
Leo1 G A 9: 75,445,549 E125K probably benign Het
Lipt1 T A 1: 37,875,301 V146E probably damaging Het
Mael A T 1: 166,235,399 probably null Het
Mga C T 2: 119,947,961 L1996F probably damaging Het
Mllt6 A G 11: 97,678,561 N913S probably damaging Het
Mphosph9 A C 5: 124,298,759 D507E probably damaging Het
Mvp G A 7: 126,987,556 A801V probably benign Het
Ndrg2 A G 14: 51,908,662 probably benign Het
Neb T C 2: 52,292,695 D1053G possibly damaging Het
Nubp1 C A 16: 10,413,721 L79I probably benign Het
Olfr397 G A 11: 73,965,420 E271K probably benign Het
Olfr924 G A 9: 38,848,509 V132I probably benign Het
Olfr97 A C 17: 37,232,332 L13V probably benign Het
Pnpla8 G A 12: 44,283,405 V29M probably benign Het
Psmb2 T A 4: 126,707,557 I151N possibly damaging Het
Ptgs2 C T 1: 150,101,354 T104I probably benign Het
Ptpro A G 6: 137,368,079 T28A probably benign Het
Raf1 A G 6: 115,626,710 probably null Het
Ranbp2 T C 10: 58,465,529 M668T probably benign Het
Rbm48 A T 5: 3,591,760 probably null Het
Rhag A T 17: 40,831,578 T225S possibly damaging Het
Rhof A C 5: 123,131,887 L69R probably damaging Het
Slc24a5 T C 2: 125,068,804 S52P probably damaging Het
Slc8a2 T C 7: 16,141,114 V429A probably damaging Het
Slfn10-ps G A 11: 83,035,562 noncoding transcript Het
Spam1 G A 6: 24,796,887 R279H probably damaging Het
Srfbp1 A G 18: 52,487,516 D102G probably damaging Het
Srrm3 A C 5: 135,873,282 probably benign Het
Trim13 G A 14: 61,605,700 V389I probably benign Het
Ttc28 A T 5: 111,235,500 Y1289F probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt1a10 T A 1: 88,056,182 V234D probably benign Het
Vmn2r18 C A 5: 151,572,930 probably benign Het
Vmn2r75 C T 7: 86,165,367 G306E probably benign Het
Vmn2r86 C T 10: 130,453,628 V133I probably benign Het
Vps13c C A 9: 67,934,476 Q1927K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp219 T A 14: 52,006,938 T550S probably benign Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp507 G A 7: 35,802,623 probably benign Het
Zfp97 T A 17: 17,145,290 F350L possibly damaging Het
Other mutations in Tk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02082:Tk1 APN 11 117825727 unclassified probably null
IGL02088:Tk1 APN 11 117824665 unclassified probably benign
blowout UTSW 11 117815953 makesense probably null
tica UTSW 11 117817122 unclassified probably benign
tico UTSW 11 117816541 missense probably damaging 1.00
tock UTSW 11 117816494 missense probably damaging 1.00
R0310:Tk1 UTSW 11 117817095 unclassified probably benign
R0811:Tk1 UTSW 11 117822107 missense probably damaging 1.00
R1180:Tk1 UTSW 11 117822095 critical splice donor site probably null
R5160:Tk1 UTSW 11 117824746 missense possibly damaging 0.78
R5287:Tk1 UTSW 11 117816541 missense probably damaging 1.00
R5846:Tk1 UTSW 11 117815922 unclassified probably benign
R5886:Tk1 UTSW 11 117817122 unclassified probably benign
R6862:Tk1 UTSW 11 117816494 missense probably damaging 1.00
R7043:Tk1 UTSW 11 117815953 makesense probably null
R7292:Tk1 UTSW 11 117825777 start codon destroyed probably null 0.01
Predicted Primers
Posted On2015-02-04