Incidental Mutation 'R0811:Kcnip4'
ID262336
Institutional Source Beutler Lab
Gene Symbol Kcnip4
Ensembl Gene ENSMUSG00000029088
Gene NameKv channel interacting protein 4
SynonymsKChIP4a, Calp250
MMRRC Submission 038991-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0811 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location48389502-49524907 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48409860 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 122 (T122S)
Ref Sequence ENSEMBL: ENSMUSP00000084656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087395] [ENSMUST00000166924] [ENSMUST00000175660] [ENSMUST00000176191] [ENSMUST00000176978]
PDB Structure
Structural Basis of KChIP4a Modulation of Kv4.3 Slow Inactivation [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000087395
AA Change: T122S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000084656
Gene: ENSMUSG00000029088
AA Change: T122S

DomainStartEndE-ValueType
EFh 124 152 6.16e-2 SMART
EFh 160 188 8.9e-8 SMART
EFh 208 236 6.14e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101214
SMART Domains Protein: ENSMUSP00000098775
Gene: ENSMUSG00000029088

DomainStartEndE-ValueType
EFh 94 122 6.16e-2 SMART
EFh 130 158 8.9e-8 SMART
Pfam:EF-hand_5 179 195 1.1e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101215
SMART Domains Protein: ENSMUSP00000098776
Gene: ENSMUSG00000029088

DomainStartEndE-ValueType
EFh 62 90 6.16e-2 SMART
EFh 98 126 8.9e-8 SMART
EFh 146 174 6.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166924
AA Change: T105S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131276
Gene: ENSMUSG00000029088
AA Change: T105S

DomainStartEndE-ValueType
EFh 107 135 6.16e-2 SMART
EFh 143 171 8.9e-8 SMART
EFh 191 219 6.14e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172363
SMART Domains Protein: ENSMUSP00000127538
Gene: ENSMUSG00000029088

DomainStartEndE-ValueType
EFh 90 118 6.16e-2 SMART
EFh 126 154 8.9e-8 SMART
EFh 174 202 6.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175660
AA Change: T97S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135799
Gene: ENSMUSG00000029088
AA Change: T97S

DomainStartEndE-ValueType
EFh 99 127 6.16e-2 SMART
EFh 135 163 8.9e-8 SMART
EFh 183 211 6.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176191
AA Change: T88S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135071
Gene: ENSMUSG00000029088
AA Change: T88S

DomainStartEndE-ValueType
EFh 62 90 6.16e-2 SMART
EFh 98 126 8.9e-8 SMART
EFh 146 174 6.14e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176521
Predicted Effect probably benign
Transcript: ENSMUST00000176978
AA Change: T101S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134758
Gene: ENSMUSG00000029088
AA Change: T101S

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
EFh 103 131 6.16e-2 SMART
EFh 139 167 8.9e-8 SMART
EFh 187 215 6.14e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199818
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belong to the recoverin branch of the EF-hand superfamily. Members of the KCNIP family are small calcium binding proteins. They all have EF-hand-like domains, and differ from each other in the N-terminus. They are integral subunit components of native Kv4 channel complexes. They may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. This protein member also interacts with presenilin. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,713,414 F858S probably damaging Het
Abcb1a T C 5: 8,713,229 S586P probably damaging Het
Ap5z1 G A 5: 142,475,791 R583H probably benign Het
Arhgap28 TCAGCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAGCAG 17: 67,901,299 probably benign Het
Arrb1 G T 7: 99,598,501 V346L probably benign Het
Atrnl1 T A 19: 57,673,141 F518I probably benign Het
Bank1 T A 3: 136,093,366 I405F probably damaging Het
Cacna1h A G 17: 25,388,628 L905P probably damaging Het
Cc2d1a A G 8: 84,133,836 Y826H probably benign Het
Cenpo A G 12: 4,216,643 V155A probably benign Het
Cnmd A G 14: 79,661,423 F63S probably damaging Het
Cnn3 G A 3: 121,454,951 G72D probably damaging Het
Cox10 A G 11: 64,071,713 S101P probably benign Het
Ctdsp1 T C 1: 74,394,647 V129A probably damaging Het
Cyp2d34 A T 15: 82,618,606 S140T probably benign Het
Dennd5a G A 7: 109,933,613 H317Y possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Enox1 T A 14: 77,582,436 D210E probably damaging Het
Fam171a1 A G 2: 3,197,427 N190S probably damaging Het
Fat2 T A 11: 55,253,633 K4138N possibly damaging Het
Fat4 A T 3: 38,957,474 D2241V probably damaging Het
Fbn1 C T 2: 125,403,170 V266I possibly damaging Het
Fras1 T A 5: 96,752,998 S3025R probably benign Het
Gba T C 3: 89,204,000 I24T probably benign Het
Gdpd5 A G 7: 99,438,333 D68G probably damaging Het
Grid1 G A 14: 34,822,619 S49N probably benign Het
Grtp1 T C 8: 13,179,639 T250A possibly damaging Het
Gucy1b1 T C 3: 82,037,988 N448D probably benign Het
Hmcn2 G A 2: 31,420,371 A3326T probably damaging Het
Ippk C A 13: 49,443,471 Q254K probably damaging Het
Itga2 A T 13: 114,870,614 L393I possibly damaging Het
Kcna10 A T 3: 107,195,259 E402V possibly damaging Het
Kcnab1 G A 3: 65,297,720 D119N probably damaging Het
Kcnma1 G A 14: 23,300,018 P1151L probably damaging Het
Klhl22 T A 16: 17,792,589 M568K probably benign Het
Krt6a C T 15: 101,692,748 V257M probably damaging Het
Ksr2 A C 5: 117,555,225 H246P probably damaging Het
Lca5 T C 9: 83,399,753 D326G possibly damaging Het
Lcp1 A G 14: 75,214,488 E393G probably benign Het
Leo1 G A 9: 75,445,549 E125K probably benign Het
Lipt1 T A 1: 37,875,301 V146E probably damaging Het
Mael A T 1: 166,235,399 probably null Het
Mga C T 2: 119,947,961 L1996F probably damaging Het
Mllt6 A G 11: 97,678,561 N913S probably damaging Het
Mphosph9 A C 5: 124,298,759 D507E probably damaging Het
Mvp G A 7: 126,987,556 A801V probably benign Het
Neb T C 2: 52,292,695 D1053G possibly damaging Het
Nubp1 C A 16: 10,413,721 L79I probably benign Het
Olfr397 G A 11: 73,965,420 E271K probably benign Het
Olfr924 G A 9: 38,848,509 V132I probably benign Het
Olfr97 A C 17: 37,232,332 L13V probably benign Het
Pithd1 A G 4: 135,977,134 probably benign Het
Pnpla8 G A 12: 44,283,405 V29M probably benign Het
Psmb2 T A 4: 126,707,557 I151N possibly damaging Het
Ptgs2 C T 1: 150,101,354 T104I probably benign Het
Ptpro A G 6: 137,368,079 T28A probably benign Het
Raf1 A G 6: 115,626,710 probably null Het
Ranbp2 T C 10: 58,465,529 M668T probably benign Het
Rbm48 A T 5: 3,591,760 probably null Het
Rhag A T 17: 40,831,578 T225S possibly damaging Het
Rhof A C 5: 123,131,887 L69R probably damaging Het
Slc22a1 T C 17: 12,666,618 probably benign Het
Slc24a5 T C 2: 125,068,804 S52P probably damaging Het
Slc8a2 T C 7: 16,141,114 V429A probably damaging Het
Spam1 G A 6: 24,796,887 R279H probably damaging Het
Spata16 T A 3: 26,913,338 probably benign Het
Srfbp1 A G 18: 52,487,516 D102G probably damaging Het
Srrm3 A C 5: 135,873,282 probably benign Het
Tbl1xr1 T A 3: 22,200,587 probably benign Het
Tk1 T C 11: 117,822,107 E98G probably damaging Het
Trim13 G A 14: 61,605,700 V389I probably benign Het
Ttc28 A T 5: 111,235,500 Y1289F probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt1a10 T A 1: 88,056,182 V234D probably benign Het
Vmn2r75 C T 7: 86,165,367 G306E probably benign Het
Vmn2r86 C T 10: 130,453,628 V133I probably benign Het
Vps13c C A 9: 67,934,476 Q1927K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp219 T A 14: 52,006,938 T550S probably benign Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Kcnip4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02749:Kcnip4 APN 5 48409785 splice site probably benign
IGL03386:Kcnip4 APN 5 48482547 missense probably damaging 1.00
R0453:Kcnip4 UTSW 5 48509712 missense probably damaging 0.96
R0812:Kcnip4 UTSW 5 48409860 missense probably benign 0.00
R0856:Kcnip4 UTSW 5 48419210 critical splice donor site probably null
R4879:Kcnip4 UTSW 5 48409865 missense possibly damaging 0.95
R6034:Kcnip4 UTSW 5 48390941 missense possibly damaging 0.89
R6034:Kcnip4 UTSW 5 48390941 missense possibly damaging 0.89
Predicted Primers
Posted On2015-02-04