Incidental Mutation 'R0811:Vmn2r75'
ID262346
Institutional Source Beutler Lab
Gene Symbol Vmn2r75
Ensembl Gene ENSMUSG00000090436
Gene Namevomeronasal 2, receptor 75
SynonymsEG546981
MMRRC Submission 038991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R0811 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86148042-86171724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86165367 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 306 (G306E)
Ref Sequence ENSEMBL: ENSMUSP00000126973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167830]
Predicted Effect probably benign
Transcript: ENSMUST00000167830
AA Change: G306E

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126973
Gene: ENSMUSG00000090436
AA Change: G306E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 80 466 2.8e-31 PFAM
Pfam:NCD3G 510 562 4.6e-20 PFAM
Pfam:7tm_3 593 829 7.7e-51 PFAM
Meta Mutation Damage Score 0.1304 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,713,414 F858S probably damaging Het
Abcb1a T C 5: 8,713,229 S586P probably damaging Het
Ap5z1 G A 5: 142,475,791 R583H probably benign Het
Arhgap28 TCAGCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAGCAG 17: 67,901,299 probably benign Het
Arrb1 G T 7: 99,598,501 V346L probably benign Het
Atrnl1 T A 19: 57,673,141 F518I probably benign Het
Bank1 T A 3: 136,093,366 I405F probably damaging Het
Cacna1h A G 17: 25,388,628 L905P probably damaging Het
Cc2d1a A G 8: 84,133,836 Y826H probably benign Het
Cenpo A G 12: 4,216,643 V155A probably benign Het
Cnmd A G 14: 79,661,423 F63S probably damaging Het
Cnn3 G A 3: 121,454,951 G72D probably damaging Het
Cox10 A G 11: 64,071,713 S101P probably benign Het
Ctdsp1 T C 1: 74,394,647 V129A probably damaging Het
Cyp2d34 A T 15: 82,618,606 S140T probably benign Het
Dennd5a G A 7: 109,933,613 H317Y possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Enox1 T A 14: 77,582,436 D210E probably damaging Het
Fam171a1 A G 2: 3,197,427 N190S probably damaging Het
Fat2 T A 11: 55,253,633 K4138N possibly damaging Het
Fat4 A T 3: 38,957,474 D2241V probably damaging Het
Fbn1 C T 2: 125,403,170 V266I possibly damaging Het
Fras1 T A 5: 96,752,998 S3025R probably benign Het
Gba T C 3: 89,204,000 I24T probably benign Het
Gdpd5 A G 7: 99,438,333 D68G probably damaging Het
Grid1 G A 14: 34,822,619 S49N probably benign Het
Grtp1 T C 8: 13,179,639 T250A possibly damaging Het
Gucy1b1 T C 3: 82,037,988 N448D probably benign Het
Hmcn2 G A 2: 31,420,371 A3326T probably damaging Het
Ippk C A 13: 49,443,471 Q254K probably damaging Het
Itga2 A T 13: 114,870,614 L393I possibly damaging Het
Kcna10 A T 3: 107,195,259 E402V possibly damaging Het
Kcnab1 G A 3: 65,297,720 D119N probably damaging Het
Kcnip4 T A 5: 48,409,860 T122S probably benign Het
Kcnma1 G A 14: 23,300,018 P1151L probably damaging Het
Klhl22 T A 16: 17,792,589 M568K probably benign Het
Krt6a C T 15: 101,692,748 V257M probably damaging Het
Ksr2 A C 5: 117,555,225 H246P probably damaging Het
Lca5 T C 9: 83,399,753 D326G possibly damaging Het
Lcp1 A G 14: 75,214,488 E393G probably benign Het
Leo1 G A 9: 75,445,549 E125K probably benign Het
Lipt1 T A 1: 37,875,301 V146E probably damaging Het
Mael A T 1: 166,235,399 probably null Het
Mga C T 2: 119,947,961 L1996F probably damaging Het
Mllt6 A G 11: 97,678,561 N913S probably damaging Het
Mphosph9 A C 5: 124,298,759 D507E probably damaging Het
Mvp G A 7: 126,987,556 A801V probably benign Het
Neb T C 2: 52,292,695 D1053G possibly damaging Het
Nubp1 C A 16: 10,413,721 L79I probably benign Het
Olfr397 G A 11: 73,965,420 E271K probably benign Het
Olfr924 G A 9: 38,848,509 V132I probably benign Het
Olfr97 A C 17: 37,232,332 L13V probably benign Het
Pithd1 A G 4: 135,977,134 probably benign Het
Pnpla8 G A 12: 44,283,405 V29M probably benign Het
Psmb2 T A 4: 126,707,557 I151N possibly damaging Het
Ptgs2 C T 1: 150,101,354 T104I probably benign Het
Ptpro A G 6: 137,368,079 T28A probably benign Het
Raf1 A G 6: 115,626,710 probably null Het
Ranbp2 T C 10: 58,465,529 M668T probably benign Het
Rbm48 A T 5: 3,591,760 probably null Het
Rhag A T 17: 40,831,578 T225S possibly damaging Het
Rhof A C 5: 123,131,887 L69R probably damaging Het
Slc22a1 T C 17: 12,666,618 probably benign Het
Slc24a5 T C 2: 125,068,804 S52P probably damaging Het
Slc8a2 T C 7: 16,141,114 V429A probably damaging Het
Spam1 G A 6: 24,796,887 R279H probably damaging Het
Spata16 T A 3: 26,913,338 probably benign Het
Srfbp1 A G 18: 52,487,516 D102G probably damaging Het
Srrm3 A C 5: 135,873,282 probably benign Het
Tbl1xr1 T A 3: 22,200,587 probably benign Het
Tk1 T C 11: 117,822,107 E98G probably damaging Het
Trim13 G A 14: 61,605,700 V389I probably benign Het
Ttc28 A T 5: 111,235,500 Y1289F probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt1a10 T A 1: 88,056,182 V234D probably benign Het
Vmn2r86 C T 10: 130,453,628 V133I probably benign Het
Vps13c C A 9: 67,934,476 Q1927K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp219 T A 14: 52,006,938 T550S probably benign Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Vmn2r75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Vmn2r75 APN 7 86148032 unclassified probably benign
IGL01287:Vmn2r75 APN 7 86148593 missense probably damaging 0.97
IGL01318:Vmn2r75 APN 7 86165566 missense probably benign 0.06
IGL01331:Vmn2r75 APN 7 86171662 nonsense probably null
IGL01406:Vmn2r75 APN 7 86163292 splice site probably benign
IGL01615:Vmn2r75 APN 7 86148473 missense probably benign 0.03
IGL01657:Vmn2r75 APN 7 86164247 missense probably damaging 1.00
IGL02237:Vmn2r75 APN 7 86165578 missense possibly damaging 0.88
IGL02275:Vmn2r75 APN 7 86165140 missense probably benign 0.04
IGL02307:Vmn2r75 APN 7 86165766 missense probably benign 0.00
IGL03136:Vmn2r75 APN 7 86148703 missense possibly damaging 0.89
IGL03160:Vmn2r75 APN 7 86148436 missense probably damaging 1.00
IGL03244:Vmn2r75 APN 7 86171725 unclassified probably benign
PIT4449001:Vmn2r75 UTSW 7 86165583 missense probably damaging 1.00
R0049:Vmn2r75 UTSW 7 86148101 nonsense probably null
R0049:Vmn2r75 UTSW 7 86148101 nonsense probably null
R0083:Vmn2r75 UTSW 7 86165658 missense probably benign 0.00
R0108:Vmn2r75 UTSW 7 86165658 missense probably benign 0.00
R0276:Vmn2r75 UTSW 7 86148307 missense probably benign 0.01
R0320:Vmn2r75 UTSW 7 86165080 missense probably benign 0.36
R0471:Vmn2r75 UTSW 7 86165513 missense probably benign 0.01
R0562:Vmn2r75 UTSW 7 86148241 nonsense probably null
R0631:Vmn2r75 UTSW 7 86163270 missense probably null 1.00
R0661:Vmn2r75 UTSW 7 86165658 missense probably benign 0.00
R0812:Vmn2r75 UTSW 7 86165367 missense probably benign 0.38
R0891:Vmn2r75 UTSW 7 86164268 missense possibly damaging 0.81
R1340:Vmn2r75 UTSW 7 86148590 missense probably damaging 0.98
R1501:Vmn2r75 UTSW 7 86165642 missense possibly damaging 0.85
R1760:Vmn2r75 UTSW 7 86148811 missense probably damaging 1.00
R1970:Vmn2r75 UTSW 7 86148262 missense probably damaging 1.00
R2060:Vmn2r75 UTSW 7 86165164 missense probably benign 0.00
R2292:Vmn2r75 UTSW 7 86148936 missense probably damaging 1.00
R3688:Vmn2r75 UTSW 7 86148421 missense probably damaging 0.99
R3892:Vmn2r75 UTSW 7 86164286 missense probably null 1.00
R4532:Vmn2r75 UTSW 7 86148141 nonsense probably null
R4583:Vmn2r75 UTSW 7 86164082 missense possibly damaging 0.81
R4592:Vmn2r75 UTSW 7 86166286 missense probably benign 0.00
R4792:Vmn2r75 UTSW 7 86163170 missense possibly damaging 0.46
R4859:Vmn2r75 UTSW 7 86148403 missense probably benign 0.35
R4896:Vmn2r75 UTSW 7 86171579 missense probably benign 0.01
R4943:Vmn2r75 UTSW 7 86165497 missense probably damaging 1.00
R4992:Vmn2r75 UTSW 7 86166167 critical splice donor site probably null
R5048:Vmn2r75 UTSW 7 86165527 missense possibly damaging 0.66
R5063:Vmn2r75 UTSW 7 86164164 missense probably benign
R5156:Vmn2r75 UTSW 7 86164228 missense possibly damaging 0.51
R5243:Vmn2r75 UTSW 7 86164239 missense probably damaging 1.00
R5277:Vmn2r75 UTSW 7 86166292 missense probably benign
R5574:Vmn2r75 UTSW 7 86166302 missense probably benign 0.22
R5622:Vmn2r75 UTSW 7 86148494 missense probably benign 0.15
R5680:Vmn2r75 UTSW 7 86171571 missense probably benign 0.10
R5884:Vmn2r75 UTSW 7 86165370 missense probably benign
R6021:Vmn2r75 UTSW 7 86171612 missense probably benign 0.01
R6217:Vmn2r75 UTSW 7 86166167 critical splice donor site probably benign
R6242:Vmn2r75 UTSW 7 86165384 missense probably damaging 1.00
R6299:Vmn2r75 UTSW 7 86165274 missense probably benign 0.12
R6441:Vmn2r75 UTSW 7 86171576 missense probably damaging 0.99
R6495:Vmn2r75 UTSW 7 86164079 missense probably benign 0.00
R6553:Vmn2r75 UTSW 7 86164245 missense probably benign 0.28
R6670:Vmn2r75 UTSW 7 86148436 missense probably damaging 1.00
R7078:Vmn2r75 UTSW 7 86166360 missense probably damaging 1.00
R7164:Vmn2r75 UTSW 7 86165384 missense probably damaging 1.00
Predicted Primers
Posted On2015-02-04