Incidental Mutation 'ANU05:Psd'
ID262519
Institutional Source Beutler Lab
Gene Symbol Psd
Ensembl Gene ENSMUSG00000037126
Gene Namepleckstrin and Sec7 domain containing
SynonymsPsdl, Efa6a, Efa6, 1110007H17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #ANU05
Quality Score192
Status Not validated
Chromosome19
Chromosomal Location46312087-46327156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46314747 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 100 (V100A)
Ref Sequence ENSEMBL: ENSMUSP00000153381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041391] [ENSMUST00000073116] [ENSMUST00000096029] [ENSMUST00000111881] [ENSMUST00000224556] [ENSMUST00000225323]
Predicted Effect probably benign
Transcript: ENSMUST00000041391
AA Change: V731A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000039728
Gene: ENSMUSG00000037126
AA Change: V731A

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 519 708 5.08e-75 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 736 744 N/A INTRINSIC
PH 757 871 1.87e-13 SMART
Blast:Sec7 900 952 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000073116
SMART Domains Protein: ENSMUSP00000072859
Gene: ENSMUSG00000025225

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096029
AA Change: V732A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000093729
Gene: ENSMUSG00000037126
AA Change: V732A

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 520 709 5.08e-75 SMART
low complexity region 715 725 N/A INTRINSIC
low complexity region 737 745 N/A INTRINSIC
PH 758 872 1.87e-13 SMART
Blast:Sec7 901 953 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111881
SMART Domains Protein: ENSMUSP00000107512
Gene: ENSMUSG00000025225

DomainStartEndE-ValueType
Pfam:RHD 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224556
AA Change: V100A

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000225323
AA Change: V732A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226062
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Plekstrin homology and SEC7 domains-containing protein that functions as a guanine nucleotide exchange factor. The encoded protein regulates signal transduction by activating ADP-ribosylation factor 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110038F14Rik G A 15: 76,950,275 V124I probably damaging Het
1700019N19Rik A T 19: 58,789,113 H80Q probably damaging Het
Acaca A G 11: 84,315,852 K1513E probably damaging Het
Acacb T A 5: 114,225,870 F1464Y probably benign Het
Adgrg6 G A 10: 14,410,530 A1114V possibly damaging Het
Agl A G 3: 116,772,789 I975T possibly damaging Het
Akap7 T C 10: 25,271,553 H93R probably damaging Het
Arhgef11 T C 3: 87,733,174 W1213R probably benign Het
Ccar1 T A 10: 62,756,649 E708V probably damaging Het
Cfap206 C T 4: 34,721,562 S162N probably damaging Het
Cilp T C 9: 65,278,983 S787P possibly damaging Het
Col6a3 G A 1: 90,802,292 T1157I probably damaging Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
Dock3 A G 9: 106,895,663 S464P probably benign Het
Dusp19 A G 2: 80,624,274 T113A probably benign Het
Dync1h1 A C 12: 110,649,104 Y2957S probably benign Het
Epdr1 T C 13: 19,594,644 Y94C probably damaging Het
Fcho1 A T 8: 71,712,547 L422Q probably benign Het
Gca T A 2: 62,690,443 Y210* probably null Het
Gpnmb T C 6: 49,055,681 V513A probably benign Het
Irx4 A G 13: 73,267,667 T192A probably damaging Het
Isca1 T C 13: 59,758,971 T54A probably benign Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
L3mbtl1 T C 2: 162,970,180 V715A probably benign Het
Lama1 G A 17: 67,738,870 D257N probably damaging Het
Lgr5 T C 10: 115,478,534 H166R probably damaging Het
M6pr A G 6: 122,312,259 R9G probably benign Het
Nmt2 T G 2: 3,314,694 S240R probably benign Het
Npas3 A G 12: 54,068,074 E593G possibly damaging Het
Olfr1076 G A 2: 86,509,169 A237T possibly damaging Het
Pank4 T C 4: 154,974,646 M412T probably damaging Het
Rab11fip3 T C 17: 26,016,113 T28A probably damaging Het
Rnpepl1 A T 1: 92,919,746 D685V probably benign Het
Rrad T C 8: 104,630,651 E88G probably benign Het
Sdk2 T A 11: 113,843,080 M846L probably benign Het
Sparcl1 A T 5: 104,094,715 V36E possibly damaging Het
Srrm4 C T 5: 116,467,569 E210K unknown Het
Stk25 A T 1: 93,623,423 probably null Het
Tacr3 A T 3: 134,930,049 Y338F probably damaging Het
Tap2 A T 17: 34,209,210 Q286L probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Tubgcp5 C A 7: 55,808,529 A396E possibly damaging Het
Ube2o T C 11: 116,540,134 D980G probably damaging Het
Vmn1r86 T C 7: 13,102,506 M98V probably benign Het
Vmn2r58 T A 7: 41,864,511 H236L probably benign Het
Zfp521 T C 18: 13,817,246 H1217R probably damaging Het
Zfyve1 A T 12: 83,555,005 F110I probably benign Het
Other mutations in Psd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Psd APN 19 46314747 missense possibly damaging 0.77
IGL01307:Psd APN 19 46314658 missense probably damaging 1.00
IGL02329:Psd APN 19 46319659 missense possibly damaging 0.66
IGL02423:Psd APN 19 46314504 missense possibly damaging 0.95
IGL02644:Psd APN 19 46323395 missense probably damaging 1.00
IGL02724:Psd APN 19 46319545 missense probably benign 0.04
IGL03117:Psd APN 19 46323122 unclassified probably benign
P0035:Psd UTSW 19 46320961 missense possibly damaging 0.56
R0054:Psd UTSW 19 46323342 missense probably damaging 1.00
R0054:Psd UTSW 19 46323342 missense probably damaging 1.00
R0403:Psd UTSW 19 46320972 unclassified probably benign
R0499:Psd UTSW 19 46322161 missense probably damaging 0.98
R0542:Psd UTSW 19 46314210 missense probably damaging 1.00
R0543:Psd UTSW 19 46319517 missense possibly damaging 0.62
R0894:Psd UTSW 19 46313441 missense probably damaging 1.00
R1449:Psd UTSW 19 46324811 missense probably damaging 0.99
R1586:Psd UTSW 19 46314798 missense probably damaging 0.98
R2096:Psd UTSW 19 46324649 unclassified probably null
R2504:Psd UTSW 19 46324913 missense possibly damaging 0.90
R2857:Psd UTSW 19 46324420 missense probably benign 0.00
R2863:Psd UTSW 19 46314762 missense probably damaging 0.97
R3897:Psd UTSW 19 46324585 missense possibly damaging 0.93
R3967:Psd UTSW 19 46324406 missense probably benign
R3970:Psd UTSW 19 46324406 missense probably benign
R4435:Psd UTSW 19 46314494 missense probably damaging 1.00
R4612:Psd UTSW 19 46313339 missense probably benign 0.15
R4940:Psd UTSW 19 46322417 missense probably damaging 1.00
R5055:Psd UTSW 19 46322468 missense probably benign 0.00
R5485:Psd UTSW 19 46316089 splice site probably null
R5768:Psd UTSW 19 46312739 missense possibly damaging 0.84
R5775:Psd UTSW 19 46314772 nonsense probably null
R6057:Psd UTSW 19 46323314 missense possibly damaging 0.77
R6349:Psd UTSW 19 46313387 unclassified probably null
R6496:Psd UTSW 19 46320314 missense probably damaging 1.00
R6614:Psd UTSW 19 46313412 missense probably benign 0.11
R6820:Psd UTSW 19 46320844 missense probably damaging 1.00
R6849:Psd UTSW 19 46317746 missense probably damaging 0.97
R6860:Psd UTSW 19 46322419 missense probably damaging 1.00
R7286:Psd UTSW 19 46314801 missense probably damaging 0.98
R7326:Psd UTSW 19 46324454 missense probably benign 0.01
R7351:Psd UTSW 19 46322430 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AGCTACCTAATCCCCTCTGGCAAG -3'
(R):5'- CGTGTCTGTCCAGGAGAAAAGTGTG -3'

Sequencing Primer
(F):5'- AGGTAGAGGATCATGCCCTTG -3'
(R):5'- AGCCCTACTCGGAGATAGCAG -3'
Posted On2015-02-04