Incidental Mutation 'ANU18:Prpf4b'
ID262553
Institutional Source Beutler Lab
Gene Symbol Prpf4b
Ensembl Gene ENSMUSG00000021413
Gene Namepre-mRNA processing factor 4B
SynonymsPrp4, Prp4k, Prpk
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #ANU18
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location34875302-34906064 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34884291 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 368 (S368P)
Ref Sequence ENSEMBL: ENSMUSP00000152654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077853] [ENSMUST00000222509]
Predicted Effect probably benign
Transcript: ENSMUST00000077853
AA Change: S368P

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077019
Gene: ENSMUSG00000021413
AA Change: S368P

DomainStartEndE-ValueType
low complexity region 40 62 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 102 123 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 156 170 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
low complexity region 210 233 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
low complexity region 299 324 N/A INTRINSIC
low complexity region 340 360 N/A INTRINSIC
low complexity region 390 417 N/A INTRINSIC
low complexity region 435 497 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
S_TKc 687 1003 4.99e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221639
Predicted Effect probably benign
Transcript: ENSMUST00000222509
AA Change: S368P

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in two sequential transesterification steps, and the protein encoded by this gene is thought to be involved in pre-mRNA splicing and in signal transduction. This protein belongs to a kinase family that includes serine/arginine-rich protein-specific kinases and cyclin-dependent kinases (CDKs). This protein is regarded as a CDK-like kinase (Clk) with homology to mitogen-activated protein kinases (MAPKs). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C T 17: 14,943,919 probably null Het
Acacb A T 5: 114,246,498 I2238L probably benign Het
Aldh1l2 T C 10: 83,522,846 Y95C probably damaging Het
Asxl2 A G 12: 3,501,425 T1056A probably damaging Het
B4galnt1 A G 10: 127,169,779 T250A possibly damaging Het
Cela3b A T 4: 137,423,843 probably null Het
Chst3 T C 10: 60,185,832 T398A probably damaging Het
Cngb3 A G 4: 19,425,625 T478A probably damaging Het
Cyp4a10 T C 4: 115,518,455 L45P probably damaging Het
D630003M21Rik A G 2: 158,217,648 S111P probably benign Het
Defb21 A G 2: 152,574,751 E49G possibly damaging Het
Dnajc1 T C 2: 18,308,834 T159A probably damaging Het
Dnmbp A G 19: 43,902,354 S325P probably benign Het
Fam91a1 T C 15: 58,442,871 F534L probably damaging Het
Fermt2 T C 14: 45,464,863 E488G probably damaging Het
Filip1 T C 9: 79,819,180 D719G possibly damaging Het
Gad1-ps A G 10: 99,445,151 noncoding transcript Het
Glra3 C A 8: 55,940,962 A36E probably benign Het
Hnrnpm C T 17: 33,669,168 probably null Het
Lct T A 1: 128,308,047 R408* probably null Het
Lrrk2 T A 15: 91,767,339 Y1733N probably damaging Het
Mindy1 T C 3: 95,288,390 L148P probably damaging Het
Mkrn2 C A 6: 115,611,789 Y164* probably null Het
Msra T C 14: 64,210,435 Y135C probably damaging Het
Ndst3 C T 3: 123,548,916 A749T probably damaging Het
Ngdn G T 14: 55,017,114 A41S probably benign Het
Nlrp12 A T 7: 3,240,092 S597T probably damaging Het
Olfr1451 A T 19: 12,999,417 I144F probably damaging Het
Pabpc6 A G 17: 9,667,970 S551P probably benign Het
Plekhg5 C T 4: 152,112,553 A752V probably benign Het
Pus7 A G 5: 23,746,424 probably null Het
Rab40b C G 11: 121,357,962 V156L probably benign Het
Slc9a9 T A 9: 95,055,459 S455T probably benign Het
Tmem26 A T 10: 68,778,606 N284Y probably damaging Het
Tmem87a T C 2: 120,380,769 I232V probably benign Het
Trpm2 A G 10: 77,923,984 L1106P probably damaging Het
Tshz1 A G 18: 84,014,661 Y541H probably damaging Het
Zfp213 G T 17: 23,561,417 A43D probably benign Het
Zfp365 A G 10: 67,909,354 V198A probably damaging Het
Zfp618 G A 4: 63,132,826 V615M probably damaging Het
Other mutations in Prpf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Prpf4b APN 13 34883907 missense probably benign 0.23
IGL00639:Prpf4b APN 13 34899173 missense possibly damaging 0.70
IGL00901:Prpf4b APN 13 34894482 missense probably damaging 1.00
IGL01301:Prpf4b APN 13 34884291 missense probably benign 0.23
IGL02027:Prpf4b APN 13 34889571 missense probably benign 0.35
IGL02111:Prpf4b APN 13 34883961 missense probably benign 0.23
IGL02256:Prpf4b APN 13 34899878 missense probably damaging 0.98
IGL02590:Prpf4b APN 13 34888146 unclassified probably benign
IGL03389:Prpf4b APN 13 34900456 splice site probably benign
IGL03411:Prpf4b APN 13 34895359 missense probably damaging 1.00
PIT4260001:Prpf4b UTSW 13 34884291 missense probably benign 0.23
PIT4696001:Prpf4b UTSW 13 34899842 missense probably benign 0.01
R0114:Prpf4b UTSW 13 34890488 splice site probably benign
R0157:Prpf4b UTSW 13 34884031 unclassified probably benign
R1551:Prpf4b UTSW 13 34894443 missense possibly damaging 0.91
R1587:Prpf4b UTSW 13 34892150 missense probably benign 0.09
R2105:Prpf4b UTSW 13 34884231 unclassified probably benign
R2152:Prpf4b UTSW 13 34900419 missense probably benign 0.04
R2432:Prpf4b UTSW 13 34883341 unclassified probably benign
R3802:Prpf4b UTSW 13 34883682 unclassified probably benign
R3803:Prpf4b UTSW 13 34883682 unclassified probably benign
R3804:Prpf4b UTSW 13 34883682 unclassified probably benign
R3982:Prpf4b UTSW 13 34884213 unclassified probably benign
R4603:Prpf4b UTSW 13 34888164 unclassified probably benign
R4633:Prpf4b UTSW 13 34900442 missense probably damaging 1.00
R4649:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R4651:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R4653:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R5022:Prpf4b UTSW 13 34883599 unclassified probably benign
R5028:Prpf4b UTSW 13 34899975 missense probably damaging 1.00
R5232:Prpf4b UTSW 13 34883590 unclassified probably benign
R5313:Prpf4b UTSW 13 34894549 missense probably damaging 1.00
R5440:Prpf4b UTSW 13 34884093 unclassified probably benign
R5511:Prpf4b UTSW 13 34884054 unclassified probably benign
R5863:Prpf4b UTSW 13 34899128 missense possibly damaging 0.51
R5981:Prpf4b UTSW 13 34886710 missense probably benign 0.23
R6360:Prpf4b UTSW 13 34901433 missense probably damaging 0.99
R6398:Prpf4b UTSW 13 34900371 missense probably damaging 1.00
R6556:Prpf4b UTSW 13 34896032 missense probably damaging 0.98
R6880:Prpf4b UTSW 13 34894453 missense possibly damaging 0.69
R7133:Prpf4b UTSW 13 34901494 missense probably benign 0.02
R7148:Prpf4b UTSW 13 34894472 missense probably benign 0.04
R7208:Prpf4b UTSW 13 34884011 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTCGGGGAAAACTTGAAATTACGGAC -3'
(R):5'- CGTGAACAGGTTACCTCGGAGAAG -3'

Sequencing Primer
(F):5'- AAGGCCAGATCTCCTGCTG -3'
(R):5'- GAGAAGAAAGTCGTCTCCTCTCTG -3'
Posted On2015-02-04