Incidental Mutation 'ANU18:Pabpc6'
ID262560
Institutional Source Beutler Lab
Gene Symbol Pabpc6
Ensembl Gene ENSMUSG00000046173
Gene Namepoly(A) binding protein, cytoplasmic 6
Synonyms4932702K14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #ANU18
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location9666497-9669704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9667970 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 551 (S551P)
Ref Sequence ENSEMBL: ENSMUSP00000050792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057190]
Predicted Effect probably benign
Transcript: ENSMUST00000057190
AA Change: S551P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050792
Gene: ENSMUSG00000046173
AA Change: S551P

DomainStartEndE-ValueType
RRM 12 85 1.78e-20 SMART
RRM 100 171 2.54e-25 SMART
RRM 192 264 1.08e-28 SMART
RRM 305 376 7.57e-24 SMART
low complexity region 500 511 N/A INTRINSIC
PolyA 561 624 3.28e-34 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C T 17: 14,943,919 probably null Het
Acacb A T 5: 114,246,498 I2238L probably benign Het
Aldh1l2 T C 10: 83,522,846 Y95C probably damaging Het
Asxl2 A G 12: 3,501,425 T1056A probably damaging Het
B4galnt1 A G 10: 127,169,779 T250A possibly damaging Het
Cela3b A T 4: 137,423,843 probably null Het
Chst3 T C 10: 60,185,832 T398A probably damaging Het
Cngb3 A G 4: 19,425,625 T478A probably damaging Het
Cyp4a10 T C 4: 115,518,455 L45P probably damaging Het
D630003M21Rik A G 2: 158,217,648 S111P probably benign Het
Defb21 A G 2: 152,574,751 E49G possibly damaging Het
Dnajc1 T C 2: 18,308,834 T159A probably damaging Het
Dnmbp A G 19: 43,902,354 S325P probably benign Het
Fam91a1 T C 15: 58,442,871 F534L probably damaging Het
Fermt2 T C 14: 45,464,863 E488G probably damaging Het
Filip1 T C 9: 79,819,180 D719G possibly damaging Het
Gad1-ps A G 10: 99,445,151 noncoding transcript Het
Glra3 C A 8: 55,940,962 A36E probably benign Het
Hnrnpm C T 17: 33,669,168 probably null Het
Lct T A 1: 128,308,047 R408* probably null Het
Lrrk2 T A 15: 91,767,339 Y1733N probably damaging Het
Mindy1 T C 3: 95,288,390 L148P probably damaging Het
Mkrn2 C A 6: 115,611,789 Y164* probably null Het
Msra T C 14: 64,210,435 Y135C probably damaging Het
Ndst3 C T 3: 123,548,916 A749T probably damaging Het
Ngdn G T 14: 55,017,114 A41S probably benign Het
Nlrp12 A T 7: 3,240,092 S597T probably damaging Het
Olfr1451 A T 19: 12,999,417 I144F probably damaging Het
Plekhg5 C T 4: 152,112,553 A752V probably benign Het
Prpf4b T C 13: 34,884,291 S368P probably benign Het
Pus7 A G 5: 23,746,424 probably null Het
Rab40b C G 11: 121,357,962 V156L probably benign Het
Slc9a9 T A 9: 95,055,459 S455T probably benign Het
Tmem26 A T 10: 68,778,606 N284Y probably damaging Het
Tmem87a T C 2: 120,380,769 I232V probably benign Het
Trpm2 A G 10: 77,923,984 L1106P probably damaging Het
Tshz1 A G 18: 84,014,661 Y541H probably damaging Het
Zfp213 G T 17: 23,561,417 A43D probably benign Het
Zfp365 A G 10: 67,909,354 V198A probably damaging Het
Zfp618 G A 4: 63,132,826 V615M probably damaging Het
Other mutations in Pabpc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Pabpc6 APN 17 9668498 missense possibly damaging 0.80
IGL00984:Pabpc6 APN 17 9668689 missense probably damaging 1.00
IGL01123:Pabpc6 APN 17 9668147 missense probably benign 0.01
IGL01301:Pabpc6 APN 17 9667970 missense probably benign
IGL02347:Pabpc6 APN 17 9669064 missense probably benign 0.03
R0022:Pabpc6 UTSW 17 9669216 missense probably benign 0.19
R0022:Pabpc6 UTSW 17 9669216 missense probably benign 0.19
R1593:Pabpc6 UTSW 17 9667813 missense probably damaging 0.98
R1695:Pabpc6 UTSW 17 9668074 missense probably benign 0.01
R3897:Pabpc6 UTSW 17 9669127 missense probably benign 0.38
R3903:Pabpc6 UTSW 17 9669154 missense probably benign 0.16
R4585:Pabpc6 UTSW 17 9669073 missense probably damaging 1.00
R5009:Pabpc6 UTSW 17 9668560 missense probably damaging 1.00
R5112:Pabpc6 UTSW 17 9669611 missense probably damaging 1.00
R5769:Pabpc6 UTSW 17 9667843 nonsense probably null
R6174:Pabpc6 UTSW 17 9668155 missense probably benign
R6488:Pabpc6 UTSW 17 9669599 missense probably damaging 1.00
R7140:Pabpc6 UTSW 17 9668428 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGCTGACTGCTTTCTGTGAAGTCTC -3'
(R):5'- TACGACATCGTACTGCCAGCACATC -3'

Sequencing Primer
(F):5'- CAACTTTGGTGTGGAGACACTC -3'
(R):5'- ATCCACACAGATGATGGGC -3'
Posted On2015-02-04