Incidental Mutation 'ANU18:1600012H06Rik'
List |< first << previous [record 25 of 33389] next >> last >|
ID262561
Institutional Source Beutler Lab
Gene Symbol 1600012H06Rik
Ensembl Gene ENSMUSG00000050088
Gene NameRIKEN cDNA 1600012H06 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #ANU18
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location14943184-14959570 bp(+) (GRCm38)
Type of Mutationunclassified (1090 bp from exon)
DNA Base Change (assembly) C to T at 14943919 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024657] [ENSMUST00000052691] [ENSMUST00000164837] [ENSMUST00000168938] [ENSMUST00000174004] [ENSMUST00000228330]
Predicted Effect probably null
Transcript: ENSMUST00000024657
SMART Domains Protein: ENSMUSP00000024657
Gene: ENSMUSG00000023883

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
low complexity region 200 207 N/A INTRINSIC
low complexity region 281 310 N/A INTRINSIC
PHD 378 433 1.22e-8 SMART
PHD 434 478 2.44e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000052691
AA Change: H103Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093344
Gene: ENSMUSG00000050088
AA Change: H103Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164837
AA Change: H103Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125970
Gene: ENSMUSG00000050088
AA Change: H103Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168938
SMART Domains Protein: ENSMUSP00000125917
Gene: ENSMUSG00000023883

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
low complexity region 200 207 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172650
Predicted Effect probably damaging
Transcript: ENSMUST00000174004
AA Change: H103Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133628
Gene: ENSMUSG00000050088
AA Change: H103Y

DomainStartEndE-ValueType
Pfam:UPF0669 1 185 7e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228221
Predicted Effect probably benign
Transcript: ENSMUST00000228330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228869
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved, N-glycosylated protein that likely functions in the cellular response to endoplasmic reticulum stress. This protein is able to induce apoptosis in vitro in CD4+ T-cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,246,498 I2238L probably benign Het
Aldh1l2 T C 10: 83,522,846 Y95C probably damaging Het
Asxl2 A G 12: 3,501,425 T1056A probably damaging Het
B4galnt1 A G 10: 127,169,779 T250A possibly damaging Het
Cela3b A T 4: 137,423,843 probably null Het
Chst3 T C 10: 60,185,832 T398A probably damaging Het
Cngb3 A G 4: 19,425,625 T478A probably damaging Het
Cyp4a10 T C 4: 115,518,455 L45P probably damaging Het
D630003M21Rik A G 2: 158,217,648 S111P probably benign Het
Defb21 A G 2: 152,574,751 E49G possibly damaging Het
Dnajc1 T C 2: 18,308,834 T159A probably damaging Het
Dnmbp A G 19: 43,902,354 S325P probably benign Het
Fam91a1 T C 15: 58,442,871 F534L probably damaging Het
Fermt2 T C 14: 45,464,863 E488G probably damaging Het
Filip1 T C 9: 79,819,180 D719G possibly damaging Het
Gad1-ps A G 10: 99,445,151 noncoding transcript Het
Glra3 C A 8: 55,940,962 A36E probably benign Het
Hnrnpm C T 17: 33,669,168 probably null Het
Lct T A 1: 128,308,047 R408* probably null Het
Lrrk2 T A 15: 91,767,339 Y1733N probably damaging Het
Mindy1 T C 3: 95,288,390 L148P probably damaging Het
Mkrn2 C A 6: 115,611,789 Y164* probably null Het
Msra T C 14: 64,210,435 Y135C probably damaging Het
Ndst3 C T 3: 123,548,916 A749T probably damaging Het
Ngdn G T 14: 55,017,114 A41S probably benign Het
Nlrp12 A T 7: 3,240,092 S597T probably damaging Het
Olfr1451 A T 19: 12,999,417 I144F probably damaging Het
Pabpc6 A G 17: 9,667,970 S551P probably benign Het
Plekhg5 C T 4: 152,112,553 A752V probably benign Het
Prpf4b T C 13: 34,884,291 S368P probably benign Het
Pus7 A G 5: 23,746,424 probably null Het
Rab40b C G 11: 121,357,962 V156L probably benign Het
Slc9a9 T A 9: 95,055,459 S455T probably benign Het
Tmem26 A T 10: 68,778,606 N284Y probably damaging Het
Tmem87a T C 2: 120,380,769 I232V probably benign Het
Trpm2 A G 10: 77,923,984 L1106P probably damaging Het
Tshz1 A G 18: 84,014,661 Y541H probably damaging Het
Zfp213 G T 17: 23,561,417 A43D probably benign Het
Zfp365 A G 10: 67,909,354 V198A probably damaging Het
Zfp618 G A 4: 63,132,826 V615M probably damaging Het
Other mutations in 1600012H06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:1600012H06Rik APN 17 14943919 unclassified probably null
IGL01606:1600012H06Rik APN 17 14943863 missense probably damaging 1.00
IGL01845:1600012H06Rik APN 17 14944118 missense probably damaging 1.00
R0556:1600012H06Rik UTSW 17 14943951 nonsense probably null
R1983:1600012H06Rik UTSW 17 14944010 missense probably damaging 0.99
R4841:1600012H06Rik UTSW 17 14943739 missense possibly damaging 0.92
R4842:1600012H06Rik UTSW 17 14943739 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCAGGTGGTGACCCTGGTAAAATG -3'
(R):5'- AGAGAACTGATTCCTCCTCTTGGGC -3'

Sequencing Primer
(F):5'- CCCTGGTAAAATGTTTGGAAGAC -3'
(R):5'- CTGCCTCTTCTGGAGCGTAAG -3'
Posted On2015-02-04