Incidental Mutation 'ANU22:Fasl'
ID262569
Institutional Source Beutler Lab
Gene Symbol Fasl
Ensembl Gene ENSMUSG00000000817
Gene NameFas ligand (TNF superfamily, member 6)
SynonymsAPT1LG1, CD178, CD95L, Fas-L, Tnfsf6
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #ANU22
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location161780689-161788495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 161781838 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 193 (V193A)
Ref Sequence ENSEMBL: ENSMUSP00000000834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000834] [ENSMUST00000193648]
Predicted Effect probably damaging
Transcript: ENSMUST00000000834
AA Change: V193A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000834
Gene: ENSMUSG00000000817
AA Change: V193A

DomainStartEndE-ValueType
low complexity region 45 70 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
TNF 143 279 2.29e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193648
SMART Domains Protein: ENSMUSP00000141422
Gene: ENSMUSG00000000817

DomainStartEndE-ValueType
Pfam:TNF 1 69 2.3e-15 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.1%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS. The FAS/FASLG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a spontaneous allele, knock-out allele, or allele producting only the soluble isoform exhibit premature death due to the development of systemic lupus erythematosus, autoimmune glomerulonephritis, hepatomegaly, lymphadenopathy, and hypergammaglobulinaemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 A G 15: 81,913,714 E663G possibly damaging Het
Adam29 T A 8: 55,871,844 H525L probably benign Het
Adamts2 A G 11: 50,737,363 N297D probably benign Het
Adamts6 T A 13: 104,390,082 V506E probably damaging Het
Ankfy1 G A 11: 72,764,791 E1101K probably damaging Het
Arap3 C T 18: 37,991,327 probably null Het
Asxl3 T A 18: 22,516,446 H497Q probably benign Het
Caln1 A G 5: 130,669,551 E96G probably damaging Het
Cdh23 T C 10: 60,312,624 T2653A probably damaging Het
Cdk5rap2 T A 4: 70,380,235 I87F possibly damaging Het
Crybg3 T A 16: 59,529,227 H934L probably damaging Het
Cyp2d22 G A 15: 82,371,668 T461I probably damaging Het
Dhcr24 T C 4: 106,572,278 F183L possibly damaging Het
Dusp16 A T 6: 134,718,861 S336T probably benign Het
F930017D23Rik T G 10: 43,604,375 noncoding transcript Het
Fgf5 T C 5: 98,275,316 Y187H probably damaging Het
Focad C A 4: 88,393,547 Q1423K probably benign Het
Gabrp T C 11: 33,555,055 T249A probably damaging Het
Galnt5 A T 2: 58,025,342 K637* probably null Het
Grm6 A T 11: 50,859,519 D503V probably benign Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Lyst C T 13: 13,678,056 R2214C probably benign Het
Micu2 T A 14: 57,943,625 D184V probably damaging Het
Nabp2 T A 10: 128,408,762 I52F probably damaging Het
Nat8f7 A T 6: 85,707,588 L90* probably null Het
Olfr1297 T C 2: 111,621,201 N291S probably damaging Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Pphln1 A G 15: 93,489,104 E273G probably damaging Het
Ppil1 C A 17: 29,263,888 V14F possibly damaging Het
Ptprd C A 4: 76,100,456 D694Y probably damaging Het
Relt A T 7: 100,851,698 L28Q probably damaging Het
Sptbn4 G A 7: 27,357,387 R2525* probably null Het
St8sia5 G A 18: 77,254,662 G320D probably damaging Het
Taf2 T C 15: 55,048,274 E582G probably damaging Het
Tas2r116 T A 6: 132,855,443 N2K probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Tmem168 A T 6: 13,583,046 V612E probably damaging Het
Unc79 A G 12: 103,001,871 S119G probably damaging Het
Washc5 T A 15: 59,355,839 K425* probably null Het
Wdr61 C A 9: 54,728,186 V44L probably damaging Het
Wtap G T 17: 12,967,895 T255K probably benign Het
Zfp148 T C 16: 33,456,943 V134A probably benign Het
Zfp397 C T 18: 23,960,751 S431L probably damaging Het
Other mutations in Fasl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Fasl APN 1 161781838 missense probably damaging 0.99
IGL01510:Fasl APN 1 161781953 missense possibly damaging 0.50
riogrande UTSW 1 161788164 missense probably benign
riogrande2 UTSW 1 161787138 missense probably benign 0.00
R0012:Fasl UTSW 1 161788164 missense probably benign
R0454:Fasl UTSW 1 161787954 missense probably benign 0.16
R2167:Fasl UTSW 1 161787138 missense probably benign 0.00
R3794:Fasl UTSW 1 161781737 missense probably benign 0.16
R3911:Fasl UTSW 1 161788191 missense probably benign 0.10
R4082:Fasl UTSW 1 161781851 missense probably damaging 1.00
R4596:Fasl UTSW 1 161788269 missense probably benign 0.31
R4622:Fasl UTSW 1 161787134 missense probably benign 0.00
R6785:Fasl UTSW 1 161781835 missense probably benign 0.10
R6969:Fasl UTSW 1 161781675 missense probably damaging 0.98
R7248:Fasl UTSW 1 161788191 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGGATAGCTGACCTGTTGGACCTTG -3'
(R):5'- TGTGTGAGCCTTTCTGCCTGAAC -3'

Sequencing Primer
(F):5'- TCCTGGTGCCCATGATAAAG -3'
(R):5'- AACGTTCCTCTCTGGTCTATTACAG -3'
Posted On2015-02-04