Incidental Mutation 'ANU22:Cdk5rap2'
ID262574
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene NameCDK5 regulatory subunit associated protein 2
Synonyms2900018K03Rik, an
Accession Numbers

Genbank: NM_145990.3

Is this an essential gene? Possibly essential (E-score: 0.589) question?
Stock #ANU22
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location70216856-70410443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70380235 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 87 (I87F)
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000144099]
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect possibly damaging
Transcript: ENSMUST00000144099
AA Change: I87F

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: I87F

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.1%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 A G 15: 81,913,714 E663G possibly damaging Het
Adam29 T A 8: 55,871,844 H525L probably benign Het
Adamts2 A G 11: 50,737,363 N297D probably benign Het
Adamts6 T A 13: 104,390,082 V506E probably damaging Het
Ankfy1 G A 11: 72,764,791 E1101K probably damaging Het
Arap3 C T 18: 37,991,327 probably null Het
Asxl3 T A 18: 22,516,446 H497Q probably benign Het
Caln1 A G 5: 130,669,551 E96G probably damaging Het
Cdh23 T C 10: 60,312,624 T2653A probably damaging Het
Crybg3 T A 16: 59,529,227 H934L probably damaging Het
Cyp2d22 G A 15: 82,371,668 T461I probably damaging Het
Dhcr24 T C 4: 106,572,278 F183L possibly damaging Het
Dusp16 A T 6: 134,718,861 S336T probably benign Het
F930017D23Rik T G 10: 43,604,375 noncoding transcript Het
Fasl A G 1: 161,781,838 V193A probably damaging Het
Fgf5 T C 5: 98,275,316 Y187H probably damaging Het
Focad C A 4: 88,393,547 Q1423K probably benign Het
Gabrp T C 11: 33,555,055 T249A probably damaging Het
Galnt5 A T 2: 58,025,342 K637* probably null Het
Grm6 A T 11: 50,859,519 D503V probably benign Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Lyst C T 13: 13,678,056 R2214C probably benign Het
Micu2 T A 14: 57,943,625 D184V probably damaging Het
Nabp2 T A 10: 128,408,762 I52F probably damaging Het
Nat8f7 A T 6: 85,707,588 L90* probably null Het
Olfr1297 T C 2: 111,621,201 N291S probably damaging Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Pphln1 A G 15: 93,489,104 E273G probably damaging Het
Ppil1 C A 17: 29,263,888 V14F possibly damaging Het
Ptprd C A 4: 76,100,456 D694Y probably damaging Het
Relt A T 7: 100,851,698 L28Q probably damaging Het
Sptbn4 G A 7: 27,357,387 R2525* probably null Het
St8sia5 G A 18: 77,254,662 G320D probably damaging Het
Taf2 T C 15: 55,048,274 E582G probably damaging Het
Tas2r116 T A 6: 132,855,443 N2K probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Tmem168 A T 6: 13,583,046 V612E probably damaging Het
Unc79 A G 12: 103,001,871 S119G probably damaging Het
Washc5 T A 15: 59,355,839 K425* probably null Het
Wdr61 C A 9: 54,728,186 V44L probably damaging Het
Wtap G T 17: 12,967,895 T255K probably benign Het
Zfp148 T C 16: 33,456,943 V134A probably benign Het
Zfp397 C T 18: 23,960,751 S431L probably damaging Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70403472 critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70380235 missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70302082 critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70317602 splice site probably benign
IGL02732:Cdk5rap2 APN 4 70266665 nonsense probably null
IGL03063:Cdk5rap2 APN 4 70354877 critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70281435 missense probably benign 0.19
F5426:Cdk5rap2 UTSW 4 70254803 missense probably benign
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70410269 start gained probably benign
R0548:Cdk5rap2 UTSW 4 70349142 critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70337375 missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70307231 missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70243508 missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70302150 missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70272679 missense probably benign
R1727:Cdk5rap2 UTSW 4 70289972 missense possibly damaging 0.70
R1768:Cdk5rap2 UTSW 4 70307233 missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70403554 splice site probably null
R2270:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70360809 critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70281271 missense probably benign
R2893:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2894:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2958:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2959:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2961:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2962:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2963:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3522:Cdk5rap2 UTSW 4 70250410 missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3919:Cdk5rap2 UTSW 4 70380223 missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70250387 missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70353614 missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70239283 critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70276715 splice site probably null
R4556:Cdk5rap2 UTSW 4 70239312 missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70315331 missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70266760 missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70266706 missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70302176 missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70238425 missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70228592 splice site probably null
R5116:Cdk5rap2 UTSW 4 70307238 missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70276651 missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70266733 missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70243593 splice site probably benign
R6177:Cdk5rap2 UTSW 4 70281482 missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70364032 missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70235454 missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70266612 missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70245396 nonsense probably null
R6959:Cdk5rap2 UTSW 4 70360669 intron probably null
R7104:Cdk5rap2 UTSW 4 70349156 missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70238231 missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70235447 missense probably benign 0.02
R7240:Cdk5rap2 UTSW 4 70291908 missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70337429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTACTAAGGGCTGCCCTAGCATC -3'
(R):5'- CCCAGTGCTATGGAGACATGCATTC -3'

Sequencing Primer
(F):5'- AGCATCATGCTGTTTCCCATAATC -3'
(R):5'- GCTATGGAGACATGCATTCTTTTTAC -3'
Posted On2015-02-04