Incidental Mutation 'ANU22:Nat8f7'
ID262581
Institutional Source Beutler Lab
Gene Symbol Nat8f7
Ensembl Gene ENSMUSG00000089694
Gene NameN-acetyltransferase 8 (GCN5-related) family member 7
SynonymsGm4477
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #ANU22
Quality Score218
Status Not validated
Chromosome6
Chromosomal Location85706727-85713205 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 85707588 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 90 (L90*)
Ref Sequence ENSEMBL: ENSMUSP00000136338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000160534] [ENSMUST00000179613] [ENSMUST00000213058]
Predicted Effect probably benign
Transcript: ENSMUST00000072018
SMART Domains Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810

DomainStartEndE-ValueType
coiled coil region 10 39 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
Blast:MYSc 127 233 1e-21 BLAST
internal_repeat_3 408 511 2.48e-7 PROSPERO
internal_repeat_2 414 804 2.09e-12 PROSPERO
internal_repeat_1 438 834 4.54e-18 PROSPERO
internal_repeat_3 652 757 2.48e-7 PROSPERO
low complexity region 903 908 N/A INTRINSIC
internal_repeat_1 916 1385 4.54e-18 PROSPERO
internal_repeat_2 1024 1390 2.09e-12 PROSPERO
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2760 2773 N/A INTRINSIC
low complexity region 2950 2968 N/A INTRINSIC
low complexity region 3013 3030 N/A INTRINSIC
Pfam:ALMS_motif 3125 3247 1.8e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160534
AA Change: L90*
SMART Domains Protein: ENSMUSP00000123947
Gene: ENSMUSG00000089694
AA Change: L90*

DomainStartEndE-ValueType
transmembrane domain 37 56 N/A INTRINSIC
Pfam:Acetyltransf_10 71 193 1.8e-10 PFAM
Pfam:Acetyltransf_4 75 204 2e-9 PFAM
Pfam:Acetyltransf_7 105 195 5.9e-11 PFAM
Pfam:Acetyltransf_1 112 194 1.2e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179613
AA Change: L90*
SMART Domains Protein: ENSMUSP00000136338
Gene: ENSMUSG00000089694
AA Change: L90*

DomainStartEndE-ValueType
transmembrane domain 37 56 N/A INTRINSIC
Pfam:Acetyltransf_10 71 193 2.2e-10 PFAM
Pfam:Acetyltransf_4 75 202 1.8e-8 PFAM
Pfam:Acetyltransf_7 105 195 5.7e-10 PFAM
Pfam:Acetyltransf_1 112 194 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213058
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.1%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 A G 15: 81,913,714 E663G possibly damaging Het
Adam29 T A 8: 55,871,844 H525L probably benign Het
Adamts2 A G 11: 50,737,363 N297D probably benign Het
Adamts6 T A 13: 104,390,082 V506E probably damaging Het
Ankfy1 G A 11: 72,764,791 E1101K probably damaging Het
Arap3 C T 18: 37,991,327 probably null Het
Asxl3 T A 18: 22,516,446 H497Q probably benign Het
Caln1 A G 5: 130,669,551 E96G probably damaging Het
Cdh23 T C 10: 60,312,624 T2653A probably damaging Het
Cdk5rap2 T A 4: 70,380,235 I87F possibly damaging Het
Crybg3 T A 16: 59,529,227 H934L probably damaging Het
Cyp2d22 G A 15: 82,371,668 T461I probably damaging Het
Dhcr24 T C 4: 106,572,278 F183L possibly damaging Het
Dusp16 A T 6: 134,718,861 S336T probably benign Het
F930017D23Rik T G 10: 43,604,375 noncoding transcript Het
Fasl A G 1: 161,781,838 V193A probably damaging Het
Fgf5 T C 5: 98,275,316 Y187H probably damaging Het
Focad C A 4: 88,393,547 Q1423K probably benign Het
Gabrp T C 11: 33,555,055 T249A probably damaging Het
Galnt5 A T 2: 58,025,342 K637* probably null Het
Grm6 A T 11: 50,859,519 D503V probably benign Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Lyst C T 13: 13,678,056 R2214C probably benign Het
Micu2 T A 14: 57,943,625 D184V probably damaging Het
Nabp2 T A 10: 128,408,762 I52F probably damaging Het
Olfr1297 T C 2: 111,621,201 N291S probably damaging Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Pphln1 A G 15: 93,489,104 E273G probably damaging Het
Ppil1 C A 17: 29,263,888 V14F possibly damaging Het
Ptprd C A 4: 76,100,456 D694Y probably damaging Het
Relt A T 7: 100,851,698 L28Q probably damaging Het
Sptbn4 G A 7: 27,357,387 R2525* probably null Het
St8sia5 G A 18: 77,254,662 G320D probably damaging Het
Taf2 T C 15: 55,048,274 E582G probably damaging Het
Tas2r116 T A 6: 132,855,443 N2K probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Tmem168 A T 6: 13,583,046 V612E probably damaging Het
Unc79 A G 12: 103,001,871 S119G probably damaging Het
Washc5 T A 15: 59,355,839 K425* probably null Het
Wdr61 C A 9: 54,728,186 V44L probably damaging Het
Wtap G T 17: 12,967,895 T255K probably benign Het
Zfp148 T C 16: 33,456,943 V134A probably benign Het
Zfp397 C T 18: 23,960,751 S431L probably damaging Het
Other mutations in Nat8f7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Nat8f7 APN 6 85707588 nonsense probably null
R1017:Nat8f7 UTSW 6 85707570 missense probably damaging 1.00
R1834:Nat8f7 UTSW 6 85707811 missense probably benign 0.01
R2389:Nat8f7 UTSW 6 85707494 missense probably benign 0.00
R5426:Nat8f7 UTSW 6 85707823 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCACTGAAGCCCTGCATCTGTG -3'
(R):5'- AGATCTTAGCCTCCGAAGTCTCCC -3'

Sequencing Primer
(F):5'- CCTGCATCTGTGCAAATTGGAG -3'
(R):5'- GGCTCCTTATCATATCCGAAAATAC -3'
Posted On2015-02-04