Incidental Mutation 'ANU22:Tas2r116'
ID262582
Institutional Source Beutler Lab
Gene Symbol Tas2r116
Ensembl Gene ENSMUSG00000030194
Gene Nametaste receptor, type 2, member 116
Synonymsmt2r56, Tas2r7, T2R16, mGR16, TRB1, Tas2r16, Tas2r14, TRB4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.042) question?
Stock #ANU22
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location132855438-132856355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132855443 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 2 (N2K)
Ref Sequence ENSEMBL: ENSMUSP00000032315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032315]
Predicted Effect probably benign
Transcript: ENSMUST00000032315
AA Change: N2K

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000032315
Gene: ENSMUSG00000030194
AA Change: N2K

DomainStartEndE-ValueType
Pfam:TAS2R 1 300 2.8e-89 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.1%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 A G 15: 81,913,714 E663G possibly damaging Het
Adam29 T A 8: 55,871,844 H525L probably benign Het
Adamts2 A G 11: 50,737,363 N297D probably benign Het
Adamts6 T A 13: 104,390,082 V506E probably damaging Het
Ankfy1 G A 11: 72,764,791 E1101K probably damaging Het
Arap3 C T 18: 37,991,327 probably null Het
Asxl3 T A 18: 22,516,446 H497Q probably benign Het
Caln1 A G 5: 130,669,551 E96G probably damaging Het
Cdh23 T C 10: 60,312,624 T2653A probably damaging Het
Cdk5rap2 T A 4: 70,380,235 I87F possibly damaging Het
Crybg3 T A 16: 59,529,227 H934L probably damaging Het
Cyp2d22 G A 15: 82,371,668 T461I probably damaging Het
Dhcr24 T C 4: 106,572,278 F183L possibly damaging Het
Dusp16 A T 6: 134,718,861 S336T probably benign Het
F930017D23Rik T G 10: 43,604,375 noncoding transcript Het
Fasl A G 1: 161,781,838 V193A probably damaging Het
Fgf5 T C 5: 98,275,316 Y187H probably damaging Het
Focad C A 4: 88,393,547 Q1423K probably benign Het
Gabrp T C 11: 33,555,055 T249A probably damaging Het
Galnt5 A T 2: 58,025,342 K637* probably null Het
Grm6 A T 11: 50,859,519 D503V probably benign Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Lyst C T 13: 13,678,056 R2214C probably benign Het
Micu2 T A 14: 57,943,625 D184V probably damaging Het
Nabp2 T A 10: 128,408,762 I52F probably damaging Het
Nat8f7 A T 6: 85,707,588 L90* probably null Het
Olfr1297 T C 2: 111,621,201 N291S probably damaging Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Pphln1 A G 15: 93,489,104 E273G probably damaging Het
Ppil1 C A 17: 29,263,888 V14F possibly damaging Het
Ptprd C A 4: 76,100,456 D694Y probably damaging Het
Relt A T 7: 100,851,698 L28Q probably damaging Het
Sptbn4 G A 7: 27,357,387 R2525* probably null Het
St8sia5 G A 18: 77,254,662 G320D probably damaging Het
Taf2 T C 15: 55,048,274 E582G probably damaging Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Tmem168 A T 6: 13,583,046 V612E probably damaging Het
Unc79 A G 12: 103,001,871 S119G probably damaging Het
Washc5 T A 15: 59,355,839 K425* probably null Het
Wdr61 C A 9: 54,728,186 V44L probably damaging Het
Wtap G T 17: 12,967,895 T255K probably benign Het
Zfp148 T C 16: 33,456,943 V134A probably benign Het
Zfp397 C T 18: 23,960,751 S431L probably damaging Het
Other mutations in Tas2r116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Tas2r116 APN 6 132855443 missense probably benign 0.02
IGL01656:Tas2r116 APN 6 132855433 unclassified probably benign
IGL01970:Tas2r116 APN 6 132855669 missense probably benign 0.07
R0490:Tas2r116 UTSW 6 132856021 missense probably benign 0.02
R2422:Tas2r116 UTSW 6 132855594 missense possibly damaging 0.88
R4013:Tas2r116 UTSW 6 132856267 missense probably damaging 1.00
R4516:Tas2r116 UTSW 6 132856150 missense probably damaging 1.00
R4745:Tas2r116 UTSW 6 132855705 missense probably benign 0.14
R4842:Tas2r116 UTSW 6 132855697 missense probably benign 0.00
Z1088:Tas2r116 UTSW 6 132855948 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCTCTAGGATGCAGTGTGAAATGC -3'
(R):5'- AGATGCTGAGACTTGTAGCAAACCAG -3'

Sequencing Primer
(F):5'- GCAGTGTGAAATGCAAACTACATC -3'
(R):5'- ATCCATTGTCCTGGGTAAAGCAC -3'
Posted On2015-02-04