Incidental Mutation 'ANU22:Relt'
ID262585
Institutional Source Beutler Lab
Gene Symbol Relt
Ensembl Gene ENSMUSG00000008318
Gene NameRELT tumor necrosis factor receptor
SynonymsE430021K24Rik, Tnfrsf19l
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #ANU22
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location100845847-100863446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100851698 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 28 (L28Q)
Ref Sequence ENSEMBL: ENSMUSP00000118150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008462] [ENSMUST00000136231] [ENSMUST00000139604] [ENSMUST00000142885] [ENSMUST00000155413] [ENSMUST00000156855]
Predicted Effect probably benign
Transcript: ENSMUST00000008462
AA Change: L28Q

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000008462
Gene: ENSMUSG00000008318
AA Change: L28Q

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TNFR 58 97 2e-4 SMART
low complexity region 132 138 N/A INTRINSIC
Pfam:RELT 170 209 1.8e-21 PFAM
coiled coil region 233 255 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
low complexity region 313 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136231
AA Change: L28Q

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121443
Gene: ENSMUSG00000008318
AA Change: L28Q

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TNFR 58 97 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139604
AA Change: L28Q

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119208
Gene: ENSMUSG00000008318
AA Change: L28Q

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TNFR 58 97 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142885
Predicted Effect probably damaging
Transcript: ENSMUST00000155413
AA Change: L28Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118150
Gene: ENSMUSG00000008318
AA Change: L28Q

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TNFR 58 97 2e-4 SMART
low complexity region 132 138 N/A INTRINSIC
Pfam:RELT 170 218 1.4e-20 PFAM
low complexity region 285 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156855
AA Change: L28Q

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120042
Gene: ENSMUSG00000008318
AA Change: L28Q

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TNFR 58 97 2e-4 SMART
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.1%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is especially abundant in hematologic tissues. It has been shown to activate the NF-kappaB pathway and selectively bind TNF receptor-associated factor 1 (TRAF1). This receptor is capable of stimulating T-cell proliferation in the presence of CD3 signaling, which suggests its regulatory role in immune response. Two alternatively spliced transcript variants of this gene encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 A G 15: 81,913,714 E663G possibly damaging Het
Adam29 T A 8: 55,871,844 H525L probably benign Het
Adamts2 A G 11: 50,737,363 N297D probably benign Het
Adamts6 T A 13: 104,390,082 V506E probably damaging Het
Ankfy1 G A 11: 72,764,791 E1101K probably damaging Het
Arap3 C T 18: 37,991,327 probably null Het
Asxl3 T A 18: 22,516,446 H497Q probably benign Het
Caln1 A G 5: 130,669,551 E96G probably damaging Het
Cdh23 T C 10: 60,312,624 T2653A probably damaging Het
Cdk5rap2 T A 4: 70,380,235 I87F possibly damaging Het
Crybg3 T A 16: 59,529,227 H934L probably damaging Het
Cyp2d22 G A 15: 82,371,668 T461I probably damaging Het
Dhcr24 T C 4: 106,572,278 F183L possibly damaging Het
Dusp16 A T 6: 134,718,861 S336T probably benign Het
F930017D23Rik T G 10: 43,604,375 noncoding transcript Het
Fasl A G 1: 161,781,838 V193A probably damaging Het
Fgf5 T C 5: 98,275,316 Y187H probably damaging Het
Focad C A 4: 88,393,547 Q1423K probably benign Het
Gabrp T C 11: 33,555,055 T249A probably damaging Het
Galnt5 A T 2: 58,025,342 K637* probably null Het
Grm6 A T 11: 50,859,519 D503V probably benign Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Lyst C T 13: 13,678,056 R2214C probably benign Het
Micu2 T A 14: 57,943,625 D184V probably damaging Het
Nabp2 T A 10: 128,408,762 I52F probably damaging Het
Nat8f7 A T 6: 85,707,588 L90* probably null Het
Olfr1297 T C 2: 111,621,201 N291S probably damaging Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Pphln1 A G 15: 93,489,104 E273G probably damaging Het
Ppil1 C A 17: 29,263,888 V14F possibly damaging Het
Ptprd C A 4: 76,100,456 D694Y probably damaging Het
Sptbn4 G A 7: 27,357,387 R2525* probably null Het
St8sia5 G A 18: 77,254,662 G320D probably damaging Het
Taf2 T C 15: 55,048,274 E582G probably damaging Het
Tas2r116 T A 6: 132,855,443 N2K probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Tmem168 A T 6: 13,583,046 V612E probably damaging Het
Unc79 A G 12: 103,001,871 S119G probably damaging Het
Washc5 T A 15: 59,355,839 K425* probably null Het
Wdr61 C A 9: 54,728,186 V44L probably damaging Het
Wtap G T 17: 12,967,895 T255K probably benign Het
Zfp148 T C 16: 33,456,943 V134A probably benign Het
Zfp397 C T 18: 23,960,751 S431L probably damaging Het
Other mutations in Relt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Relt APN 7 100851698 missense probably damaging 1.00
IGL01958:Relt APN 7 100851143 missense probably benign 0.16
P4717OSA:Relt UTSW 7 100847581 missense probably damaging 1.00
R0026:Relt UTSW 7 100850221 nonsense probably null
R0384:Relt UTSW 7 100847505 missense probably benign 0.26
R0437:Relt UTSW 7 100848784 unclassified probably benign
R0626:Relt UTSW 7 100848816 missense probably damaging 1.00
R1582:Relt UTSW 7 100851353 critical splice donor site probably null
R1802:Relt UTSW 7 100850194 missense probably damaging 0.98
R5977:Relt UTSW 7 100863148 intron probably benign
R6924:Relt UTSW 7 100847261 missense probably damaging 1.00
R6994:Relt UTSW 7 100853114 splice site probably benign
Predicted Primers PCR Primer
(F):5'- AGTTCTGCATAATGTGCCCTGTCC -3'
(R):5'- CAATGGCTTGAGGTCCTGATCCTG -3'

Sequencing Primer
(F):5'- GGAGATTACAAGCCTGAAGCCA -3'
(R):5'- GCTTTCCAGTATTTTCCAGAAGCAG -3'
Posted On2015-02-04