Incidental Mutation 'ANU22:Adamts2'
ID262594
Institutional Source Beutler Lab
Gene Symbol Adamts2
Ensembl Gene ENSMUSG00000036545
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2
SynonymsADAM-TS2, procollagen N-proteinase, hPCPNI, a disintegrin and metalloproteinase with thrombospondin repeats
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #ANU22
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50602084-50807573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50737363 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 297 (N297D)
Ref Sequence ENSEMBL: ENSMUSP00000040171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040523]
Predicted Effect probably benign
Transcript: ENSMUST00000040523
AA Change: N297D

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000040171
Gene: ENSMUSG00000036545
AA Change: N297D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 44 52 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 211 2.6e-39 PFAM
low complexity region 214 225 N/A INTRINSIC
coiled coil region 236 260 N/A INTRINSIC
Pfam:Reprolysin_5 265 450 1.4e-15 PFAM
Pfam:Reprolysin_4 267 464 7.1e-11 PFAM
Pfam:Reprolysin 268 471 2.4e-20 PFAM
Pfam:Reprolysin_2 285 463 9.1e-14 PFAM
Pfam:Reprolysin_3 289 420 8.7e-13 PFAM
TSP1 565 617 9.73e-17 SMART
Pfam:ADAM_spacer1 724 838 5.1e-33 PFAM
low complexity region 839 853 N/A INTRINSIC
TSP1 858 915 1.05e-3 SMART
TSP1 918 977 2.78e-3 SMART
TSP1 980 1030 4.99e-5 SMART
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.1%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin repeats) family of proteinases that is involved in the proteolytic processing of procollagens. The encoded protein precursor is proteolytically processed to generate a mature, zinc-dependent enzyme. Mice lacking the encoded protein develop abnormal lungs, fragile skin and male sterility. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous mutation of this gene results in a short snout, male infertility, and thin skin that is torn by scratching or handling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 A G 15: 81,913,714 E663G possibly damaging Het
Adam29 T A 8: 55,871,844 H525L probably benign Het
Adamts6 T A 13: 104,390,082 V506E probably damaging Het
Ankfy1 G A 11: 72,764,791 E1101K probably damaging Het
Arap3 C T 18: 37,991,327 probably null Het
Asxl3 T A 18: 22,516,446 H497Q probably benign Het
Caln1 A G 5: 130,669,551 E96G probably damaging Het
Cdh23 T C 10: 60,312,624 T2653A probably damaging Het
Cdk5rap2 T A 4: 70,380,235 I87F possibly damaging Het
Crybg3 T A 16: 59,529,227 H934L probably damaging Het
Cyp2d22 G A 15: 82,371,668 T461I probably damaging Het
Dhcr24 T C 4: 106,572,278 F183L possibly damaging Het
Dusp16 A T 6: 134,718,861 S336T probably benign Het
F930017D23Rik T G 10: 43,604,375 noncoding transcript Het
Fasl A G 1: 161,781,838 V193A probably damaging Het
Fgf5 T C 5: 98,275,316 Y187H probably damaging Het
Focad C A 4: 88,393,547 Q1423K probably benign Het
Gabrp T C 11: 33,555,055 T249A probably damaging Het
Galnt5 A T 2: 58,025,342 K637* probably null Het
Grm6 A T 11: 50,859,519 D503V probably benign Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Lyst C T 13: 13,678,056 R2214C probably benign Het
Micu2 T A 14: 57,943,625 D184V probably damaging Het
Nabp2 T A 10: 128,408,762 I52F probably damaging Het
Nat8f7 A T 6: 85,707,588 L90* probably null Het
Olfr1297 T C 2: 111,621,201 N291S probably damaging Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Pphln1 A G 15: 93,489,104 E273G probably damaging Het
Ppil1 C A 17: 29,263,888 V14F possibly damaging Het
Ptprd C A 4: 76,100,456 D694Y probably damaging Het
Relt A T 7: 100,851,698 L28Q probably damaging Het
Sptbn4 G A 7: 27,357,387 R2525* probably null Het
St8sia5 G A 18: 77,254,662 G320D probably damaging Het
Taf2 T C 15: 55,048,274 E582G probably damaging Het
Tas2r116 T A 6: 132,855,443 N2K probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Tmem168 A T 6: 13,583,046 V612E probably damaging Het
Unc79 A G 12: 103,001,871 S119G probably damaging Het
Washc5 T A 15: 59,355,839 K425* probably null Het
Wdr61 C A 9: 54,728,186 V44L probably damaging Het
Wtap G T 17: 12,967,895 T255K probably benign Het
Zfp148 T C 16: 33,456,943 V134A probably benign Het
Zfp397 C T 18: 23,960,751 S431L probably damaging Het
Other mutations in Adamts2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Adamts2 APN 11 50803701 missense probably benign 0.00
IGL01366:Adamts2 APN 11 50796468 missense probably damaging 1.00
IGL01412:Adamts2 APN 11 50795403 missense probably benign 0.43
IGL01443:Adamts2 APN 11 50803863 missense possibly damaging 0.54
IGL01974:Adamts2 APN 11 50776174 missense probably damaging 0.99
IGL02267:Adamts2 APN 11 50792678 missense probably benign 0.00
IGL02498:Adamts2 APN 11 50773308 missense possibly damaging 0.81
IGL02498:Adamts2 APN 11 50777196 missense probably damaging 1.00
IGL02626:Adamts2 APN 11 50776255 missense probably damaging 0.99
IGL02634:Adamts2 APN 11 50792721 nonsense probably null
IGL02643:Adamts2 APN 11 50788700 missense probably benign 0.01
IGL02836:Adamts2 APN 11 50787279 missense probably damaging 1.00
IGL03012:Adamts2 APN 11 50776269 splice site probably benign
H8441:Adamts2 UTSW 11 50784678 missense probably damaging 1.00
R0050:Adamts2 UTSW 11 50775395 missense probably damaging 1.00
R0050:Adamts2 UTSW 11 50775395 missense probably damaging 1.00
R0240:Adamts2 UTSW 11 50775374 missense probably damaging 1.00
R0240:Adamts2 UTSW 11 50775374 missense probably damaging 1.00
R0491:Adamts2 UTSW 11 50776630 missense probably damaging 0.98
R0501:Adamts2 UTSW 11 50668145 missense probably benign 0.16
R0570:Adamts2 UTSW 11 50776136 missense probably damaging 1.00
R0588:Adamts2 UTSW 11 50776664 missense probably damaging 1.00
R0647:Adamts2 UTSW 11 50603438 missense probably damaging 1.00
R0760:Adamts2 UTSW 11 50775326 missense probably damaging 1.00
R0784:Adamts2 UTSW 11 50668003 missense probably damaging 1.00
R1163:Adamts2 UTSW 11 50779714 missense probably damaging 1.00
R1623:Adamts2 UTSW 11 50668115 missense possibly damaging 0.79
R1641:Adamts2 UTSW 11 50792785 missense probably damaging 1.00
R1779:Adamts2 UTSW 11 50756697 missense probably damaging 0.99
R2163:Adamts2 UTSW 11 50788805 missense probably benign 0.36
R2177:Adamts2 UTSW 11 50777228 missense probably damaging 0.98
R2508:Adamts2 UTSW 11 50788689 missense possibly damaging 0.82
R3721:Adamts2 UTSW 11 50773211 splice site probably benign
R4092:Adamts2 UTSW 11 50787276 missense probably damaging 0.99
R4691:Adamts2 UTSW 11 50756696 missense probably damaging 1.00
R4785:Adamts2 UTSW 11 50792722 missense probably benign 0.00
R4809:Adamts2 UTSW 11 50803690 missense probably benign 0.17
R4823:Adamts2 UTSW 11 50737187 missense probably benign 0.26
R4927:Adamts2 UTSW 11 50803812 nonsense probably null
R4976:Adamts2 UTSW 11 50737366 missense possibly damaging 0.67
R5118:Adamts2 UTSW 11 50781869 missense probably damaging 0.99
R5478:Adamts2 UTSW 11 50792651 missense possibly damaging 0.83
R5660:Adamts2 UTSW 11 50776645 missense probably damaging 1.00
R5734:Adamts2 UTSW 11 50788667 missense probably damaging 1.00
R5865:Adamts2 UTSW 11 50803954 nonsense probably null
R6079:Adamts2 UTSW 11 50756706 missense probably damaging 1.00
R6138:Adamts2 UTSW 11 50756706 missense probably damaging 1.00
R6257:Adamts2 UTSW 11 50775326 missense probably damaging 1.00
R6540:Adamts2 UTSW 11 50788740 missense possibly damaging 0.77
R6897:Adamts2 UTSW 11 50737164 critical splice acceptor site probably null
R7103:Adamts2 UTSW 11 50737354 missense probably damaging 0.98
U15987:Adamts2 UTSW 11 50756706 missense probably damaging 1.00
X0065:Adamts2 UTSW 11 50803649 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTGTGCCCAAATGGGTTCTGTC -3'
(R):5'- TCCAGCCCAATTCGCCAATGTC -3'

Sequencing Primer
(F):5'- AAAGAAGGTGTCCTTTCCTTCCAG -3'
(R):5'- AATGTCCTACTCTCTGATGGACC -3'
Posted On2015-02-04